If I may add this. You can step through your data line by line getting what you want, then to get all your "Nucleotide Sequence", since you have a "blanck" line used as delimiter, then you could use perl "flip-flop" operator (..) as it is called like so: 

use warnings;
use strict;


while(<DATA>){
  if(/Name:\s+?(.+?)$/){
    print $1,$/;
  }
  if(/Nucleotide Sequence/../^\s*$/){ # use "flip-flop" operator
     s/.*:\s+?//;  # remove the Nucleotide Sequence to :,then print
    print
  }
}

__DATA__
GeneID: 1002
Name: cadherin 4, type 1, R-cadherin (retinal)
Chromo: 20
Cytoband: 20q13.3
Nucleotide Sequence: atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggc
acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagcagtacacag
cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa

GeneID: 10077
Name: tetraspanin 32
Chromo: 11
Cytoband: 11p15.5
Nucleotide Sequence: atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc

GeneID: 10078
Name: tumor suppressing subtransferable candidate 4
Chromo: 11
Cytoband: 11p15.5
Nucleotide Sequence: atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa

[download]
Produces .. 
cadherin 4, type 1, R-cadherin (retinal)
atgaccgcgggcgccggcgtgctccttctgctgctctcgctctccggc
acagcgagactggagatatcgtcacagtggcggctggcctggaccgagagaaagttcagcagtacacag
cagcttgcgcatcctgtacctggaggccgggatgtatgacgtccccatcatcgtcacagactctggaaa

tetraspanin 32
atggggccttggagtcgagtcagggttgccaaatgccagatgctggtc

tumor suppressing subtransferable candidate 4
atggctgaggcaggaacaggtgagccgtcccccagcgtggagggcgaa

[download]

If you tell me, I'll forget.
If you show me, I'll remember.
if you involve me, I'll understand.
--- Author unknown to me

In reply to Re: Extracting multiple rows in a text file with a regex. by 2teez
in thread Extracting multiple rows in a text file with a regex. by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.