Hi, I'm kind of new to Perl and I am comparing 2 strings of different size containing DNA nucleotides. I want the script to take the smaller string and locate it in the much larger string allowing for mismatches and providing me with the sequence it found in the larger string plus adjacent 5 nucleotides on either side. So for example if I have 2 strings: #1 ATGATCCTG #2 TCGAGTGGCCATGAACGTGCCAATTG I want the script to take #1 and find the same sequence in #2 which is present but with 2 mismatches, along with 5 nucleotides on either side. Thank you so much!

In reply to Comparing 2 different-sized strings by AdrianJ217

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.