Hello all, I started to use Perl a couple a days ago and would like to ask my first question... I have been using BioPerl and all seems to be OK, however I cannot use StandAloneBlast. I've followed "http://www.bioperl.org/wiki/HOWTO:Beginners" down to BLAST, which I have installed as instructed on "http://www.ncbi.nlm.nih.gov/books/NBK52637/" but this is where the problems begin. To put it simply, I don’t know how to use/install NCBI Blast for use with BioPerl. I put a sequence database "Anopheles-gambiae-PEST_TRANSCRIPTS_AgamP3.7.fa" into the “db” folder of “blast-2.2.28+”. I then attempted to use the BLAST tool to find a specific DNA sequence within my database, as instructed on the bioperl beginners page. 

#!/bin/perl -w
use warnings;
use Bio::Seq;
use Bio::Tools::Run::StandAloneBlast;
 
$blast_obj = Bio::Tools::Run::StandAloneBlast->new(-program  => 'blast
+n', -database => 'Anopheles-gambiae-PEST_TRANSCRIPTS_AgamP3.7.fa');
 
$seq_obj = Bio::Seq->new(-id  =>"AGAP007280_query", -seq =>"TCTCGAGATG
+GCGAACCTGCTGCAGGGGTTCAGCGAGATGGGTCCAGCCAAAGAGAAGACGACGCCACAGTATGAGG")
+;
 
$report_obj = $blast_obj->blastall($seq_obj);
 
$result_obj = $report_obj->next_result;
 
print $result_obj->num_hits;

[download]

The output is as follows: 

Replacement list is longer than search list at C:/Dwimperl/perl/site/l
+ib/Bio/Ran
ge.pm line 251.
Use of uninitialized value $_[0] in string eq at C:/Dwimperl/perl/lib/
+File/Spec/
Win32.pm line 152.

--------------------- WARNING ---------------------
MSG: cannot find path to blastall
---------------------------------------------------
Can't call method "next_result" on an undefined value at bioperl_blast
+2.pl line
12.

[download]

I don't know how to define the path to blastall, which for the moment is probably the biggest issue. I’m not sure if I have been very clear, but I’m very new to this… thanks in advance!

In reply to BLAST and BioPerl by GeneticistDrew

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.