Dear Monks,

My current task involves string alignments, for which I found a very promising C/C++ library that I would like to call from my Perl code. The library can be found here: https://github.com/mengyao/Complete-Striped-Smith-Waterman-Library

and an example for C++ usage can be found here:

https://github.com/mengyao/Complete-Striped-Smith-Waterman-Library/blob/master/src/example.cpp

What I had in mind is, to create either a subroutine or a separate module that passes the sequences (query and ref in the example) to the C function. Several variables can then store the returned results. Unfortunately, I do not even get the first part running with only one variable being returned (disclaimer: I am not a C programmer and Inline sounds cool, but is also new to me).

Based on the C++ package, I wrote the following piece to get a general understanding of what is going on, which results in "Undefined subroutine &main::do_SSW called at ./somePerl.pl line 8.". FYI, the CIGAR string is a compact format to display alignments, see:

http://genome.sph.umich.edu/wiki/SAM#What_is_a_CIGAR.3F

Many thanks in advance, any help is greatly appreciated.
#!/usr/bin/perl use warnings; use Inline CPP => Config => AUTO_INCLUDE => '#include "ssw_cpp.h"'; my $ref = "CAGCCTTTCTGACCCGGAAATCAAAATAGGCACAACAAA"; my $seq = "CTGAGCCGGTAAATC"; my $cigar = do_SSW($seq,$ref); print "$cigar\n"; __END__ __CPP__ static string do_SSW(const string query, const string ref) { StripedSmithWaterman::Aligner aligner; StripedSmithWaterman::Filter filter; StripedSmithWaterman::Alignment alignment; aligner.Align(query.c_str(), ref.c_str(), ref.size(), filter, &ali +gnment); return alignment.cigar_string; }

In reply to Including existing C or CPP library using Inline by bontus

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.