Hello Monks I'm new here as you can see. I'm a student in bioinformatics and I'm starting to learn Perl hopping that one day I will become a monk :D . So the problem at hand I need to take sequences from a tabular txt document the format of the sequences is this (24 11 AAAGAAAGCTGAAGACTAAAGAAA) the first number is the number of the sequence the second number is the number i need it says how many times should the sequence be copied. I dont know how to make it I mean I have a base code but its full of holes . Here is a short example of what i need the code to do : 
1 2 tt # the first two are the sequence from the doc
2 3 aa

1 tt -> 1-1 
      tt
2 tt -> 1-2
      tt
3 aa -> 2-1
          aa #and so on 
I will give you my code (but i dont think it will help :/ )

#!/usr/bin/perl\
open FH "<", "filename.txt" or die $!;
open FHWRITE, ">>results.txt" or die $!;
 
$seq1 =  #dont know how for the $ to take the value of the first seq1 
$countnumb = split (' ',); # dont know how to take the second number f
+or count number but i think its whit split 
$count =0; 
while ($count ne $countnumb)
{
print "$seq1";
$count++;
}
 # i dont know when this finishes how to make it go for the second seq

[download]
need help :D

In reply to Code that copy's multiple times a $ from a document by Waterdrake

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.