Thats a very common problem, you are trying to add a record only when the successor is to be parsed, but the last record has no successor (sic ;)!

Most people try to solve by repeating code to add the last record after the loop.

But it's much cleaner this way (avoiding a posteriori state logic) 

use strict;
use warnings;
use Data::Dump;

my $header;
my %sequence;

while ( my $line = <DATA> ){
    chomp $line; 
    if ( $line =~ /^>(.*)/ ) {
        $header = $1;
    } else {
        $sequence{$header} .= $line;
    }
}

dd \%sequence;

    
    
__DATA__
>sequence_5849
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>sequence_5959
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>sequence_0808
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT

[download]
output 
{
  sequence_0808 => "CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGAC
+CAGCCCGGACTGGGAACCTGCGGGCAGTAGGTGGAAT",
  sequence_5849 => "CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTC
+CGGCCTTCCCTCCCACTAATAATTCTGAGG",
  sequence_5959 => "CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCG
+CCGAAGGTCTATATCCATTTGTCAGCAGACACGC",
}

[download]

Cheers Rolf

( addicted to the Perl Programming Language)

update

a *general pattern* to solve such problems while staying DRY is to use references 

    if ( $line =~ /^(HEAD_PATTERN)/ ) {
        $data    = \ $deeply{nested}{structure}{$1}; # reference data 
+       
    } else {
        $$data .= $line;                            # derefrence data
    }

[download]

like this you don't need to repeat the path of a deeply nested data structure, which might vary in multiple dimensions

update
added some explanation

In reply to Re^3: Reading file into a hash (last record problem) by LanX
in thread Reading file into a hash by PerlSufi

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.