Dear all, I am new to perl and trying to learn the various concepts related to the language. I am trying to parse a aligned dna sequences and printing when each position the alphabets are same. If there is a mismatch then it should skip that and print the next consnsus sequence in new line. Here I am posting the code and sample file. Any help will be greatly appreciated. Thank you all 

#!/usr/bin/perl
use warnings;
use strict;
my $seqcount; my $pos; my $arrlen;
my @arr = ();
open (B, "temp.dat");
while (my $line=<B>)
{
    chomp $line;
    $seqcount++;
    $line =~ s/\s//g;
    my @temp = split (//, $line);
    $arrlen = scalar(@temp);
    for ($pos=0;$pos<=scalar(@temp);$pos++)
    {
        $arr[$seqcount][$pos] = $temp[$pos];
    }
}
my $max_position = 0;
$max_position = $arrlen if($arrlen > $max_position);
for ($pos=0;$pos<=$max_position;$pos++)
{
    for (my $s=1;$s<=$seqcount;$s++)
    {
        if ($arr[$s][$pos] ne $arr[$seqcount][$pos])
        {
            print "\n";            
            next;
        }
        else
        {
            print "$arr[$s][$pos]";
        }
    }
}

[download]
temp.dat
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctg
+aatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccgg
+c
atagctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctg
+aatcctgcggacgacccctctcgtggtcgtttggggctctgccgccctcttctccgcctgccgttcagg
+c
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctg
+aatcctgcggacgacccctctcgtggtcgcttggggctctgccgccctcttctccgcctgccgttccgg
+c
atggctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctg
+aatcctgcggacgacccctctcgtggtcgcttggggctctaccgccctcttctccgcctgccgttccgg
+c

[download]
Desired output
at
gctgctaggctgtgctgccaactggatcctgcgcgggacgtcctttgtctacgtcccgtcggcgctgaat
+cctgcggacgacccctctcgtggtcg
ttggggctct
ccgccctcttctccgcctgccgttc
ggc

[download]

In reply to Comparing array of aligned sequences by newtoperlprog

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.