Dear All,

I have written a small piece of code which reads in 19bp fragment of DNA string and does some calculations and prints the results.

What I am trying to do is to apply a filter to the code such that if the target sequence (column 3 in sample data file) is less than or greater than 19bp and/or if the fragment contains letters other than A or T or G or C, it should write a log file with the errors showing sequence and error value of length. The program would do calculation only if the target sequence pass the above criteria. Could it be done while reading the file in while loop ( as I have tried below in the code)? Any help is greatly appreciated and I am also attaching the output form the program. 

#!/usr/bin/perl
use strict;
use warnings;

my $file = $ARGV[0];
my @file = split(/\./,$file);
my $name = $file[0];

my $splitcolumn = $ARGV[1]; # splitcolumn value is 2

if ($#ARGV != 1 ) 
{
    print "Usage: Program_name filename column_number\n";
    exit;
}

open (X, ">", $name."_detailed_info.txt");
open (Y, ">", "temp_".$name."_concatenate.dat");
open (ERR, ">",$name."_log.file");
my @alphabets = ("A".."H"); my @numbers = (1..12);
my $cellno = 1; my $count=1; my $alphacounter=0; 
my $numcounter = 0; my $targetlen = 19;
my $errseq=1; my $errlen =1; my @seq;
#print X "#Name\tTarget_Seq(5'->3')\tTarget_len\tTarget_GC%\tShort_mRN
+A(5'->3')\tSense_Strand\tSS_len\tSS_GC%\tAntiSense_Strand(5'->3')\tAn
+it_Sense\tAS_len\n";
open (A, "<","$file") or die "Could not open the file, $!";
while(my $line = <A>)
{
    chomp $line;
        if ($line =~/^\s*$/)
        {next;}
    my @temp = split(/\s/,$line);
#    my $seq = uc($temp[2]); #Target mRNA, length 19 bp
    my $seq = uc($temp[$splitcolumn]); #Target mRNA, length 19 bp
        my @tempseq = split (//,$seq);
        foreach my $tempseq(@tempseq)
        {
            if ($tempseq !~/[ATGC]/ig)
            {
            print ERR "Error: Target sequence # $errseq: [".$seq."] ha
+s bases other than ATGC.\n";
                next;
            }
        }
                
    my $lenseq = length($seq);
        if ($lenseq < $targetlen || $lenseq > $targetlen)
        {
            print ERR "Error: Target sequence # $errseq: [".$seq."] is
+ of ".length($seq)."-bp.\n";
            next;
        }
        $errseq++;
        
    my $a = ($seq=~tr/A//);
    my $t = ($seq=~tr/T//);
    my $g = ($seq=~tr/G//);
    my $c = ($seq=~tr/C//);
    my $GCper = sprintf ("%.2f", (($g+$c)/$lenseq)*100);
    my $ATper = sprintf ("%.2f", (($a+$t)/$lenseq)*100);

    my $mrna = $seq;
    $mrna =~ s/T/U/g;
    $mrna =~ /\w{3}(.*)\w{1}/;
    my $shortmrna = $1; #Short mRNA, first 3 and last 1 base removed
#   print "$shortmrna\n";
    my $lenshortmrna = length ($shortmrna);
    my $aa = ($shortmrna=~tr/A//);
    my $uu = ($shortmrna=~tr/U//);
    my $gg = ($shortmrna=~tr/G//);
    my $cc = ($shortmrna=~tr/C//);
    my $GCCper = sprintf ("%.2f", (($gg+$cc)/$lenshortmrna)*100);
    my $ATTper = sprintf ("%.2f", (($aa+$uu)/$lenshortmrna)*100);

    my $antisense = $seq;
    $antisense =~ tr/ATGCatgc/UACGuacg/;
    my $reverse = "AA".reverse($antisense); #Antisense strand made fro
+m target mRNA, added two A's at beginning.
#   print "$reverse\n";
    my $lenreverse = length($reverse);
    print X "$name$count\t$seq\t$lenseq\t$GCper\t$shortmrna\tSS\t$lens
+hortmrna\t$GCCper\t$reverse\tAS\t$lenreverse\n"; #Detailed informatio
+n print
    print Y "$name$count\tSS\t$shortmrna\n"; #tempfile print
    print Y "$name$count\tAS\t$reverse\n"; #tempfile print 
    $count++;        
}
close (A); close (X); close (Y);

[download]
K-ras 132       caggctcaggacttagcaa     GCUCAGGACUUAGCA AAUUGCUAAGUCCU
+GAGCCUG   47.6    41.9    19      15      21
K-ras 135       cttagcaagaagttatgaaa    AGCAAGAAGUUAUGG AAUCCAUAACUUCU
+UGCUAAG   33.3    36.5    19      15      21
K-ras 133       ggcycaggacttagcaaga     UCAGGACUUAGCAAG AAUCUUGCUAAGUC
+CUGAGCC   47.6    39.2    19      15      21
K-ras 134       caggacttagcaaoooaagtt   GACUUAGCAAGAAGU AAAACUUCUUGCUA
+AGUCCUG   38.1    36.5    19      15      21

[download]
My output:
Error: Target sequence # 2: [CTTAGCAAGAAGTTATGAAA] is of 20-bp.
Error: Target sequence # 2: [GGCYCAGGACTTAGCAAGA] has bases other than
+ ATGC.
Error: Target sequence # 3: [CAGGACTTAGCAAOOOAAGTT] has bases other th
+an ATGC.
Error: Target sequence # 3: [CAGGACTTAGCAAOOOAAGTT] has bases other th
+an ATGC.
Error: Target sequence # 3: [CAGGACTTAGCAAOOOAAGTT] has bases other th
+an ATGC.
Error: Target sequence # 3: [CAGGACTTAGCAAOOOAAGTT] is of 21-bp.

[download]

In reply to Filter and writing error log file by newtoperlprog

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.