Dear Roboticus and Anonymous Monk

Thank you for your suggestions and directions and I am extremely sorry for any confusion if any.

As you mentioned in your earlier post, that this will not work if the sequences are overlapping and I have found that some of my regions would be overlapping.

I was also thinking if this could be done by an array of range operator and for each array element the sequence will be either bold or colored.

Below is my code which I was trying:

#!/usr/bin/perl
#use strict;
use warnings;

my $filename =  "NM_014143.3.fasta";
my @name     = split( /\./, $filename );
my $name     = $name[0];
my ($infile, @temp);
open( $infile, "<", $filename ) || die "Check the $filename $!\n";
while ( my $line = <$infile> ) 
{
    chomp $line;
    if    ( $line =~ /^>/ )    { next; }
    elsif ( $line =~ /^\s*$/ ) { next; }
    elsif ( $line =~ /^\s*#/ ) { next; }
    else                       { $sequence .= $line; }
}
$sequence =~ s/\n//g;
$sequence =~ s/\s+//g;
#print "$sequence\n";
close ($infile);

my @seq = (1 .. 15, 30 .. 40, 50 .. 60); #this is a range array

for (my $pos=1;$pos<=length($sequence);$pos++){
    foreach my $ar(@seq){
    if($pos == $ar){
        push (@temp, "<b>",$sequence, "</b");
    }
    else{
        push (@temp, $sequence);
    }
    }
}
my $tmp = join ("", @temp);
print "$tmp\n";

[download]
Data file:
GGCGCAACGCTGAGCAGCTGGCGCGTCCCGCGCGGCCCCAGTTCTGCGCAGCTTCCCGAGGCTCCGCACC
+                                                                   CC
+TGCAGGGCATTCCAGAAAGATGAGGATATTTGCTGTCTTTATATTCATGACCATTTGCTGAACGCATT
TACTGTCACGGTTCCCAAGGACCTATATGTGGTAGAGTATGGTAGC                        
+                                                                   AT
+GACAATTGAATGCAAATTCCCAGTAGAAAAACAATTAGACCTGGCTGCACTAATTGTCTATTGGG
AAATGGAGGATAAGAACATTATTCAATTTGTGCATGGAGAGGAAGACCTGAAGGTTCAGCATAGTAGCTA
CAGACAGAGGGCCCGGCTGTTGAAGGACCAGCTCTCCCTGGGAAATGCTGCACTTCAGATCACAGATGTG
AAATTGCAGGATGCAGGGGTGTACCGCTGCATGATCAGCTATGGTGGTGCCGACTACAAGCGAATTACTG
TGAAAGTCAATGCCCCATACAACAAAATCAACCAAAGAATTTTGGTTGTGGATCCAGTCACCTCTGAACA
TGAACTGACATGTCAGGCTGAGGGCTACCCCAAGGCCGAAGTCATCTGGACAAGCAGTGACCATCAAGTC
CTGAGTGGTAAGACCACCACCACCAATTCCAAGAGAGAGGAGAAGCTTTTCAATGTGACCAGCACACTGA

[download]

In reply to Re^3: bold color text and export to file by newtoperlprog
in thread bold color text and export to file by newtoperlprog

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.