Ok, here's breaking into groups of 50 (had to make some changes to HTML-ize it for Perlmonks display, but you should get the idea): 

c:\@Work\Perl\monks>perl -wMstrict -le
"my $red  = '<font color=\"red\">';
 my $blue = '<font color=\"blue\">';
 my $post = '</font>';
 my $brk  = qq{<br> \n};
 ;;
 my $base = qr{ [ATCG] }xms;
 ;;
 my $sequence = 'GGCGCAACGCTGAGCAGCTGGCGCGTCCCGCGCGGCCCCAGTTCTGCGCAGCT
+TCCCGAGGCTCCGCACCAGCCGCGCTTCTGCCGCCTGCAGGGCATT';
 ;;
 my $colorized_seq =
   join '',
   map qq{$red$_$post$brk},
   map { s{ ($base{1,10} \z) }{$blue$1$post}xms;  $_; }
   $sequence =~ m{ $base{1,50} }xmsg
   ;
 print qq{[[ $colorized_seq]]};
"
[[ <font color="red">GGCGCAACGCTGAGCAGCTGGCGCGTCCCGCGCGGCCCCA<font col
+or="blue">GTTCTGCGCA</font></font><br>
<font color="red">GCTTCCCGAGGCTCCGCACCAGCCGCGCTTCTGCCGCCT<font color="
+blue">GCAGGGCATT</font></font>
<br>
]]

[download]
Which looks like:
GGCGCAACGCTGAGCAGCTGGCGCGTCCCGCGCGGCCCCAGTTCTGCGCA
GCTTCCCGAGGCTCCGCACCAGCCGCGCTTCTGCCGCCTGCAGGGCATT

In reply to Re^2: Code optimization help and troubleshooting by AnomalousMonk
in thread Code optimization help and troubleshooting by newtoperlprog

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.