Dear AnomalousMonk and Athanasius

Thank you for your suggestions and comments, I have incorporated suggestions and it really shortened the code.

Could I get some help in the debugging, somehow, in the sequence after 1-10 character the 11th character is getting truncated. I checked the code for substr and couldn't figure out why this is happening.

and I am trying to color the last 10 (91-100) characters in blue while reading in for loop.

Again thank you for your help.


#!/usr/bin/perl
use strict;
use warnings;
use LWP::Simple;
use Data::Dumper;

my $sequence="GGCGCAACGCTGAGCAGCTGGCGCGTCCCGCGCGGCCCCAGTTCTGCGCAGCTTCC
+CGAGGCTCCGCACCAGCCGCGCTTCTGTCCGCCTGCAGGGCATT";

############ Make hash of rejected length ###############
my $input = "fragments.txt";
my %split;

open (my $infile, "<", $input) or die "Cannot open file '$input' for r
+eading: $!";
build_hash($_) while <$infile>;
close ($infile) or die "Cannot close file '$input': $!";

build_hash(length($sequence) + 1);
sub build_hash{
    use feature 'state';
    state $old = 0;
    state $cnt = 1;
    my ($line) = @_;
    my $gap = $line - $old;
    my $start = $old + 1;
    my $end = ($gap > 2) ? $line - 1 : $start;
    $split{$cnt++} = [$start .. $end] if $gap >= 2;
    $old = $line;
}
############# Write HTML file #############################
#my $header;
open (AA, ">fragments.html") or die "Cannot open file:$!";
print AA <<"EndOfHTML";
<!DOCTYPE html PUBLIC "-//W3C//DTD XHTML 1.0 Strict//EN" "http://www.w
+3.org/TR/xhtml1/DTD/xhtml1-strict.dtd">
    <html xmlns="http://www.w3.org/1999/xhtml" lang="en" xml:lang="en"
+>
    <head>
    <title> Colored Gene Walk</title> <meta http-equiv="content-type" 
+content="text/html;charset=utf-8"/>
    </head>
    <body>
    <pre class="monofont">
    <a style="font-size: 12pt">
EndOfHTML
#print AA "$header\n";
my $red  = '<span style="color:red">';
my $span = '</span>';
my $brk  = qq{<br />\n};

    for (my $pos=1;$pos<=length($sequence);$pos++){
    my $FLAG=0;my @temp=();
    foreach my $k(sort {$a <=> $b} keys %split){
        my @pos=@{$split{$k}};
        my $p1 =$pos[0];
        my $p2 =$pos[$#pos];
        if($pos == $p1){
        push (@temp, $red);
        for(my $p=$p1;$p<=$p2;$p++){
            my $s=substr($sequence,$p-1,1);
            push (@temp,$s);
            if($p==int($p/50)*50){
            push (@temp, $brk);
            }
            $FLAG=1; $pos++;
        }
        push (@temp, $span);
        }
    }
    if($FLAG ==0){
        my $s=substr($sequence,$pos-1,1);
        print AA "$s";
    }
    else{
        printf AA join("",@temp);
    }
    if($pos==int($pos/50)*50){
        printf  AA "$brk";
    }
}

print AA <<"EndOfHTML";
</a>
    </pre>
    </body>
    </html>
EndOfHTML
    close (AA);

[download]

In reply to Re: Code optimization help and troubleshooting by newtoperlprog
in thread Code optimization help and troubleshooting by newtoperlprog

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.