Does this do what you want? There is no need to split the sequence into an array as pos will allow you to find where in a string a match has been made. Note that [^ACGT] is a negative character class, i.e. match anything that isn't A, C, G or T. Using capturing parentheses, ( ... ), and matching globally, m{ ... }g or / ... /g will advance along the sequence looking for invalid letters.

I am opening a file that is held inside the script just to keep things tidy on my system but the code will work fine with STDIN. The code.

use 5.026;
use warnings;

open my $dnaFH, q{<}, \ <<__EOD__ or die $!;
TAAGAACAATAAGAACAAGAACAATAA
GAACAATAAGXAATAAGAAXXAACAAGAACAATAA
ACAATAAAAGAACAATAAGAA
__EOD__

while ( my $sequence = <$dnaFH> )
{
    chomp $sequence;
    my $length = length $sequence;
    say qq{Sequence: $sequence -- Length $length};
    if ( $sequence =~ m{^[ACGT]+$} )
    {
        say q{     Sequence is GOOD!};
    }
    else
    {
        my @badPosns;
        push @badPosns, pos $sequence
           while $sequence =~ m{(?x) (?= ( [^ACGT] ) )}g;
        my $nBad = scalar @badPosns;
        my $perc = sprintf q{%.2f}, $nBad / $length * 100;
        say qq{     Sequence is BAD at @badPosns};
        say qq{     $nBad bad positions, $perc\% of total};
    }
}

close $dnaFH or die $!;

[download]

The output.

Sequence: TAAGAACAATAAGAACAAGAACAATAA -- Length 27
     Sequence is GOOD!
Sequence: GAACAATAAGXAATAAGAAXXAACAAGAACAATAA -- Length 35
     Sequence is BAD at 10 19 20
     3 bad positions, 8.57% of total
Sequence: ACAATAAAAGAACAATAAGAA -- Length 21
     Sequence is GOOD!

[download]

I hope this is helpful. Please ask further if you need more help.

Update: There was a mistake in the code, I should have used a look-ahead assertion as without that pos gives the position after the match, not that of the match itself. Added extended syntax ((?x)) to make the regex clearer. My bad :-(

Update 2: I should also have corrected the output, now done.

Cheers,

JohnGG

In reply to Re: Find element in array by johngg
in thread Find element in array by Sofie

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.