Hi I have a fasta file containing a number of sequences. I would like to extract only the sequences that are of a specific length (lets's say >10 nt). The sequences are wrapped with new lines, so when trying to read into an array, each line becomes an element. How can I removed these? I have tried join, but it also removes the newline between sequences and puts all of it into single string. How do I separate each sequence into an element or string?

The file looks something like this: 


>NM_001 Homo sapiens ADA2 (CECR1)
GATCCAA
>NM_002 Homo sapiens IKBKG
GGAGGTCTTTAGCTTTAGGGAAACCC

[download]
Output should be only the second sequence in this case. 
#!/usr/bin/perl -w


#open the fastfile Genes.fasta
open (GENES, "Genes.fasta") or die "Could not open file";
chomp (@seq = <GENES>);
$seq = join ("\n", @seq);

$lengthseq = length $seq;

#min length of the seq
$minlength = 10;

#if length is over a certain size, print
if ($lengthseq > $minlength){
    print $seq;
    }
else {print "No sequence is over $minlength;"
}

[download]

In reply to Size of sequences in fastafile by Sofie

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.