It's still not very clear precisely what you expect but here's my final stab at this.

use strict;
use warnings;

use Test::More tests => 1; # Present this SSCCE as a test

my @seq; # Sequences longer than $min are stored here
my @want = (
    'GGAGGTCTTTAGCTTTAGGGAAACCC',
); # These are the sequeneces we expect for the given data set
my $min = 15; # Minimum length of any sequence to be considered

my $this = '';
while (<DATA>) {
    chomp;
    if (/^>/) {
        push @seq, $this if $min <= length $this;
        $this = '';
    } else {
        $this .= $_;
    }
}
push @seq, $this if $min <= length $this;

is_deeply \@seq, \@want; # Check that our algorithm has worked

__DATA__
>NM_001 Homo sapiens ADA2 (CECR1)
GATCCAA
>NM_002 Homo sapiens IKBKG
GGAGGTCTTTAGCTTTAGGGAAACCC

[download]

In reply to Re^3: Size of sequences in fastafile by hippo
in thread Size of sequences in fastafile by Sofie

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.