Hello Monks! Hope you are all fine, Monks, to my knowledge i am applying the following regex in my code to extract only id's i.e: (first part of each line NM_030643.4,NR_029834.1,NM_001198855.1, AC067940.1)of the file. but it is returning this "APOL4) CYP2C8)" instead.

The file:

 
>NM_030643.4 Homo sapiens apolipoprotein L4 (APOL4) 
GAGGTGCTGGGGAGCAGCGTGTTTGCTGTGCTTGATTGTGAGCTGCTGGGAAGTTGTGACTTTCATTTTA
CCTTTCGAATTCCTGGGTATATCTTGGGGGCTGGAGGACGTGTCTGGTTATTATATAGGTGCACAGCTGG
>NM_001198855.1 Homo sapiens cytochrome P450 family 2 subfamily C memb
+er 8 (CYP2C8)
ACATGTCAAAGAGACACACAC
>NR_029834.1 Homo sapiens microRNA 200a (MIR200A), microRNA
CCGGGCCCCTGTGAGCATC
>AC067940.1 Homo sapiens clone RP11-818E9, LOW-PASS SEQUENCE SAMPLING
AAATACAACTTTAAATCAAAACGGTAAAAATTCCACTCTTTCATACTAACTTCAAAAGTATTTGCTTTAA
AAAAAAAGNNNNNNNNN

[download]
open(GENBANK, "/Users/Desktop/Genes.fasta") or die; 
my $content = join("", <GENBANK>); 
close(GENBANK);

sub mysub{
return shift =~ /(\w+\W+)\n/g;
 
}
my @matches = mysub($content);
print "@matches\n";

[download]

In reply to Extracting string and numbers from a file by shabird

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.