Hello shabird,

Your regex says: match one or more word characters, followed by one or more non-word characters, followed immediately by a newline; and return the characters matched minus the newline. This won’t work.

What you need is a way to uniquely identify the IDs. From the file contents shown, it looks as though each ID is immediately preceded by a > character. If so, you could use something like this:

#! perl

use strict;
use warnings;
use Data::Dump;

my   @matches;
push @matches, mysub($_) for <DATA>;
dd  \@matches;

sub mysub
{
    return shift =~ / > (\S+) \s /gx;
}

__DATA__
 
>NM_030643.4 Homo sapiens apolipoprotein L4 (APOL4) 
GAGGTGCTGGGGAGCAGCGTGTTTGCTGTGCTTGATTGTGAGCTGCTGGGAAGTTGTGACTTTCATTTTA
CCTTTCGAATTCCTGGGTATATCTTGGGGGCTGGAGGACGTGTCTGGTTATTATATAGGTGCACAGCTGG
>NM_001198855.1 Homo sapiens cytochrome P450 family 2 subfamily C memb
+er 8 (CYP2C8)
ACATGTCAAAGAGACACACAC
>NR_029834.1 Homo sapiens microRNA 200a (MIR200A), microRNA
CCGGGCCCCTGTGAGCATC
>AC067940.1 Homo sapiens clone RP11-818E9, LOW-PASS SEQUENCE SAMPLING
AAATACAACTTTAAATCAAAACGGTAAAAATTCCACTCTTTCATACTAACTTCAAAAGTATTTGCTTTAA
AAAAAAAGNNNNNNNNN

[download]

Output:

23:46 >perl 2038_SoPW.pl
["NM_030643.4", "NM_001198855.1", "NR_029834.1", "AC067940.1"]

23:46 >

[download]

Hope that helps,

Athanasius <°(((>< contra mundum Iustus alius egestas vitae, eros Piratica,

In reply to Re: Extracting string and numbers from a file by Athanasius
in thread Extracting string and numbers from a file by shabird

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.