I was trying to make a perl code to get the reverse complement of fasta sequences of DNA in a .fna file format. the sequence02C.fna file contains 100s of DNA sequences :

>adbca3e
TGCTCCCCACGCTTGCCTCTCCAGTACTCAACCAAAGCAGTCTCTAGAAAAACAGTTTCCAACGCAATAC
+GATGGAATTCCACTTCCCAAATATCTC
>4c2a958
TCCCCACGCTTTCGCGCTTCAGCGTCAGTATCTGTCCAGTGAGCTGACTTCTCCATCGGCATTCCTACAC
+AGTACTCTAGAAAAACAGTTTCTGCTC
>0639b5b
TCGCGCCTCAGTGTCCAACGCAATACGAGTTGCAGACCAGGACACATGGAATTCCACTTCCCTCTCCAGT
+ACTCAACCAAAGCAGTCTCTAGAAAAG

[download]

output file is only the complementary of the sequence but not reverse. Additionally, it does not contain the sequenceIDs(ASVs) ">adbca3e"

Could anyone please suggest me the appropriate code to do this reverse complementary of this sequence at once? Thanks in advance. 

#!/usr/local/perl

open (NS, "sequence02C.fna");
while (<NS>) {
if ($_ =~ tr/ATGC/TACG/) {print $_;}
}

[download]

In reply to Perl code for reverse complement of DNA sequence by mashuk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.