G'day mashuk,

Welcome to the Monastery.

[I appreciate this is your first post here. For future reference, please read "How do I post a question effectively?". Also consider the comments others have made in this thread.]

For demonstration purposes, I've truncated your DNA sequences to 20 characters. I believe what you're after is code something like this (pm_11131708_fasta_rev_comp.pl): 

#!/usr/bin/env perl

use strict;
use warnings;
use autodie;

my $in_file = 'pm_11131708_in';
my $out_file = 'pm_11131708_out';

{
    open my $in_fh, '<', $in_file;
    open my $out_fh, '>', $out_file;

    while (<$in_fh>) {
        if (0 == index $_, '>') {
            print $out_fh $_;
        }
        else {
            chomp;
            my $rev = scalar reverse;
            $rev =~ y/ATGC/TACG/;
            print $out_fh "$rev\n";
        }
    }
}

[download]

Sample run:

$ cat pm_11131708_in
>adbca3e
TGCTCCCCACGCTTGCCTCT
>4c2a958
TCCCCACGCTTTCGCGCTTC
>0639b5b
TCGCGCCTCAGTGTCCAACG

$ ./pm_11131708_fasta_rev_comp.pl

$ cat pm_11131708_out
>adbca3e
AGAGGCAAGCGTGGGGAGCA
>4c2a958
GAAGCGCGAAAGCGTGGGGA
>0639b5b
CGTTGGACACTGAGGCGCGA

[download]

See also: autodie, open, index and reverse.

— Ken

In reply to Re: Perl code for reverse complement of DNA sequence by kcott
in thread Perl code for reverse complement of DNA sequence by mashuk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.