Using up my quota of guesses for the day...

This will get all valid substrings of longer valid strings. 

#!/usr/bin/perl

use strict; # https://perlmonks.org/?node_id=11137405
use warnings;

my $random = join '', map qw(A C G T)[rand 4], 1 .. 50;

for my $seq ( qw( AGCAGC AATGCAATCGCAGCAGCA AGCTACCCAGCTAGGGAGCTA
  AAA_x_AAA_x_BBB_x_AAA_x_AAA_x_BBB
  ), $random )
  {
  my %found;
  $seq =~ /([A-Z]{3,}) .* \1 (?{ $found{$1}++ }) (*FAIL)/x;
  my %counts = map { $_, scalar(() = $seq =~ /$_/g) } keys %found;
  use Data::Dump 'dd'; dd "for sequence $seq", \%counts;
  }

[download]

Outputs: 

("for sequence AGCAGC", { AGC => 2 })
(
  "for sequence AATGCAATCGCAGCAGCA",
  { AAT => 2, AGC => 2, CAG => 2, GCA => 4 },
)
(
  "for sequence AGCTACCCAGCTAGGGAGCTA",
  { AGC => 3, AGCT => 3, AGCTA => 3, CTA => 3, GCT => 3, GCTA => 3 },
)
(
  "for sequence AAA_x_AAA_x_BBB_x_AAA_x_AAA_x_BBB",
  { AAA => 4, BBB => 2 },
)
(
  "for sequence ATGGACTGCCTGGAAGAATCATCCATCCTGGGGCCCGGATCTTTGTACCC",
  {
    ATC   => 4,
    ATCC  => 2,
    CAT   => 2,
    CATC  => 2,
    CCC   => 2,
    CCT   => 2,
    CCTG  => 2,
    CCTGG => 2,
    CTG   => 3,
    CTGG  => 2,
    GAA   => 2,
    GCC   => 2,
    GGA   => 3,
    TCC   => 2,
    TGG   => 3,
    TGGA  => 2,
  },
)

[download]

In reply to Re: count backrefenence regex by tybalt89
in thread count backrefenence regex by tmolosh

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.