Using up my quota of guesses for the day...
This will get all valid substrings of longer valid strings.
#!/usr/bin/perl use strict; # https://perlmonks.org/?node_id=11137405 use warnings; my $random = join '', map qw(A C G T)[rand 4], 1 .. 50; for my $seq ( qw( AGCAGC AATGCAATCGCAGCAGCA AGCTACCCAGCTAGGGAGCTA AAA_x_AAA_x_BBB_x_AAA_x_AAA_x_BBB ), $random ) { my %found; $seq =~ /([A-Z]{3,}) .* \1 (?{ $found{$1}++ }) (*FAIL)/x; my %counts = map { $_, scalar(() = $seq =~ /$_/g) } keys %found; use Data::Dump 'dd'; dd "for sequence $seq", \%counts; }
Outputs:
("for sequence AGCAGC", { AGC => 2 }) ( "for sequence AATGCAATCGCAGCAGCA", { AAT => 2, AGC => 2, CAG => 2, GCA => 4 }, ) ( "for sequence AGCTACCCAGCTAGGGAGCTA", { AGC => 3, AGCT => 3, AGCTA => 3, CTA => 3, GCT => 3, GCTA => 3 }, ) ( "for sequence AAA_x_AAA_x_BBB_x_AAA_x_AAA_x_BBB", { AAA => 4, BBB => 2 }, ) ( "for sequence ATGGACTGCCTGGAAGAATCATCCATCCTGGGGCCCGGATCTTTGTACCC", { ATC => 4, ATCC => 2, CAT => 2, CATC => 2, CCC => 2, CCT => 2, CCTG => 2, CCTGG => 2, CTG => 3, CTGG => 2, GAA => 2, GCC => 2, GGA => 3, TCC => 2, TGG => 3, TGGA => 2, }, )
In reply to Re: count backrefenence regex
by tybalt89
in thread count backrefenence regex
by tmolosh
| For: | Use: | ||
| & | & | ||
| < | < | ||
| > | > | ||
| [ | [ | ||
| ] | ] |