Hi All,

I am a newbie at Perl and am trying to teach myself to become better. I would like to ask for some wisdom.

I have some code and know what it's doing but I can't get my head around how it's actually doing it. I have a fasta file (micro.txt) with several microRNAs in the form of: >hsa-let-7a-5pTGAGGTAGTAGGTTGTATAGTT>hsa-let-7a-3pCTATACAA......etc the code is:

my $micro = 'micro.txt'; open(IN, $micro) or die "Can't open file $micro because $!\n"; while(my $line=<IN>) { if ($line=~/>/) { chomp($line); $line=~s/>//; my $sequence=<IN>; chomp($sequence); } close(IN);

I know that the code is separating the 'header' (i.e.>hsa-let-7a-5p) and 'sequence' part (i.e. TGAGGTAGTAGGTTGTATAGTT) but how is this doing it by just using chomp? My understanding was that chomp just removed any whitespace at the end of a line?? Please help!!


In reply to Not sure how it's working? by theward

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.