BLAST RESULT FILE BLASTN 2.2.31+ Reference: Zheng Zhang, Scott Schwartz, Lukas Wagner, and Webb Miller (2000), "A greedy algorithm for aligning DNA sequences", J Comput Biol 2000; 7(1-2):203-14. Database: Arabidopsis_thaliana.mRNA.EST.fasta 1,529,700 sequences; 400,627,814 total letters Query= Contig1 Length=941 +Score E Sequences producing significant alignments: ( +Bits) Value gi|61656031|gb|DN604734.1|DN604734 EST JCAt1g22640 Arabidopsis ... +219 4e-055 > gi|61656031|gb|DN604734.1|DN604734 EST JCAt1g22640 Arabidopsis Gateway cDNA Library Arabidopsis thaliana cDNA 3', mRNA sequence. Length=740 Score = 219 bits (118), Expect = 4e-055 Identities = 263/334 (79%), Gaps = 6/334 (2%) Strand=Plus/Minus Query 60 AAAGGAGCTTGGACTAAAGAAGAAGATGAACGACTTATTTCTTATAT--TAAAACTCA +CG 117 ||||||||||||||||||||||||||| | | ||| || ||| || ||| || +|| Sbjct 734 AAAGGAGCTTGGACTAAAGAAGAAGATCAGCTTCTTGTTGATTACATCCGTAAA--CA +CG 677 Query 118 GCGAAGGTTGCTGGAGATCCCTTCCTAAAGCTGCCGGACTTCTCCGATGCGGTAAAAG +TT 177 | |||||||||||| |||| || ||| || || ||| | | |||| ||||| || +|| Sbjct 676 GTGAAGGTTGCTGGCGATCTCTCCCTCGCGCCGCTGGATTACAAAGATGTGGTAAGAG +TT 617 Query 178 GCCGTCTCCGATGGATTAATTACTTGAGACCGGACCTTAAACGCGGTAATTTTACTGA +AG 237 | | | ||||||| ||||| | ||||| || || ||| | || ||||||||||| +|| Sbjct 616 GTAGATTGAGATGGATGAATTATCTAAGACCAGATCTCAAAAGAGGCAATTTTACTGA +AG 557 Query 238 AAGAAGATGAACTCATTATCAAACTCCATAGCCTCCTTGGTAACAAATGGTCACTTAT +AG 297 |||||||||||||||| ||||| ||||||||| | || |||||||||||||| | || +|| Sbjct 556 AAGAAGATGAACTCATCATCAAGCTCCATAGCTTGCTCGGTAACAAATGGTCTTTAAT +AG 497 Query 298 CCGGAAGATTACCAGGAAGAACAGATAATGAGATAAAAAATTACTGGAATACGCACAT +-A 356 | || ||||||||||||||||||||||| ||||| || || || ||||| || || || + | Sbjct 496 CTGGGAGATTACCAGGAAGAACAGATAACGAGATCAAGAACTATTGGAACACTCATAT +CA 437 Query 357 AGAAGGAAGCTTTTGAGTCGGGGCATTGATCCAA 390 || ||||||||| | || || || |||||||||| Sbjct 436 AG-AGGAAGCTTCTCAGCCGTGGGATTGATCCAA 404 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 326667943382 Query= Contig2 Length=1009 ***** No hits found ***** Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 350998085934 Query= Contig3 Length=529 ***** No hits found ***** Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 180381608828 Query= Contig4 Length=896 +Score E Sequences producing significant alignments: ( +Bits) Value gi|152034016|gb|AU239642.2|AU239642 EST AU239642 RAFL21 Arabido... +167 1e-039 > gi|152034016|gb|AU239642.2|AU239642 EST AU239642 RAFL21 Arabidopsis thaliana cDNA clone RAFL21-11-C04 5', mRNA sequence. Length=632 Score = 167 bits (90), Expect = 1e-039 Identities = 260/345 (75%), Gaps = 2/345 (1%) Strand=Plus/Plus Query 232 ATTGCCAATACTAAGTCTTGGTTCCAATTCTATGGCGACGGCTTTTCTATTCGTGTTC +CA 291 ||||| || ||||||||||||||||| | || ||| || || ||||| | |||| +| Sbjct 286 ATTGCGAACACTAAGTCTTGGTTCCAGTACTTTGGTAGTGGGTTCGCTATTAGGGTTC +CT 345 Query 292 CCGGAATTTCAGGACCTCACTGAGCCGGAGGATTATAATGCTGGCCTATCACTATATG +GA 351 || || ||| | ||| ||| |||||| |||||||| ||| || | || || |||| +| Sbjct 346 CCTGACTTTGAAGACGTCAATGAGCCTGAGGATTACTCTGCGGGATTGTCTCTCTATG +GT 405 Query 352 GATAAGGCTAAGCCCAAAAAATTT-GCAGCACGTTTTGCTTCTTCTGATGGATCCGAA +GT 410 || ||||| ||||| | ||| ||| || || || || || |||||||||| ||| +|| Sbjct 406 GACAAGGCAAAGCC-ACAAACTTTCGCCGCCCGGTTCCAAACTCCTGATGGATCAGAA +GT 464 Query 411 TTTAAGTGTCATAATTCGTCCATCCAATCAGCTGAAGATCACTTTCTTAGAGGCTAAA +GA 470 ||| ||||| | |||||||| || ||||| || |||||||||||||||||||||||| +|| Sbjct 465 TTTGAGTGTAGTCATTCGTCCTTCAAATCAACTTAAGATCACTTTCTTAGAGGCTAAA +GA 524 Query 471 TATTACTGATTTAGGTTCACTTAAGGAGGCAGCAAAAATATTTGTTCCAGCTGGCTCA +AC 530 ||| ||||||| || ||| | |||| || |||| | | |||||||||| || || +|| Sbjct 525 TATATCTGATTTGGGATCATTGAAGGCAGCTGCAAGACTTTTTGTTCCAGGTGCNGCA +AC 584 Query 531 ACTATATTCTGTCCGCACAATAAAAATTAAAGAAGATGAGGGTTT 575 | | || |||| || ||||| || | || ||||| || ||||| Sbjct 585 AATTTACTCTGCTCGTACAATCAAGGTAAAGGAAGAAGAAGGTTT 629 Lambda K H 1.33 0.621 1.12 Gapped Lambda K H 1.28 0.460 0.850 Effective search space used: 310567113752

In reply to Re^2: BLAST RESULT FILE by vineetha
in thread how to create output file using perl by vineetha

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.