Hi all, I have this simple perl script working on an xml file, I want to print two attributes
and one element, I just got two attributes, the element "observed", is not printed
Could you help me to fix it please this is my code
Thanks in advance ========================= 
use XML::Twig;
my $file = 'sample.xml';
my $twig = XML::Twig->new();
$twig->parsefile($file);
my $root = $twig->root;
foreach my $species ($root->descendants('Ss'))
{
print $species->att('ssId');
print "\t";
print $species->att('handle');
print "\t"; 
print $species->next_sibling_text('Observed');
print "\n";
}

[download]
======================== This is part of the file ====================== 
<?xml version="1.0" encoding="UTF-8"?>
<ExchangeSet xmlns:xsi="http://www.w3.org/2001/XMLSchema-instance" xml
+ns="http:/
/www.ncbi.nlm.nih.gov/SNP/docsum" xsi:schemaLocation="http://www.ncbi.
+nlm.nih.go
v/SNP/docsum ftp://ftp.ncbi.nlm.nih.gov/snp/specs/docsum_3.4.xsd" spec
+Version="3
.4" dbSnpBuild="144" generated="2015-05-26 09:54">
    <SourceDatabase taxId="9606" organism="human" gpipeOrgAbbr="hs"/>
    <Rs rsId="3894" snpClass="snp" snpType="notwithdrawn" molType="gen
+omic" genotype="true" bitField="050028000005130500030100" taxId="9606
+">
        <Het type="est" value="0.05" stdError="0.1547"/> 
        <Validation byCluster="true" byOtherPop="true" byHapMap="true"
+ by1000G="
true"> 
            <otherPopBatchId>7179</otherPopBatchId>
        </Validation>
        <Create build="36" date="2000-09-19 17:02"/> 
        <Update build="144" date="2015-05-07 10:52"/> 
        <Sequence exemplarSs="491581208" ancestralAllele="C,C">
            <Seq5>ATAAGCAAATAACTGAAGTTTAATCAGTCTCCTCCCAGCAAGTGATATGCAA
+CTGAGATTCC
TTATGACACATCTGAACACTAGTGGATTTGCTTTGTAGTAGGAACAAGGTACATTCGCGGGATAAATGTG
+GCCAAGTTTT
ATCTGCTGCCAGGGCTTTCAAATAGGTTGACCTGACAATGGGTCACCTCTGGGACTGA</Seq5> 
            <Observed>C/T</Observed>
            <Seq3>AATTAGGAAGAGCTGGTACCTAAAATGAAAGATGCCCTTAAATTTCAGATTC
+ACAATTTTTT
TTTCTTAGTATAAGCATGTCCCATGTAATATCTGGGATATACTCATACCTTTAAAAATGTGCTCATTGTT
+TATCTGAAAT
TCACATTTTAACAGGGAACCATTGTTTTGTTATTGTTTATTGTTTTGTTTCTAAATAA</Seq3>
        </Sequence>
        <br> <Ss ssId="3931" handle="OEFNER" batchId="489" locSnpId="M
+3" subSnpClass="snp" orient="forward" strand="bottom" molType="genomi
+c" buildId="36" methodClass="DHPLC" validated="by-cluster">
            <Sequence> 
                <Seq5>TAATCAGTCTCCTCCCAGCAAGTGATATGCAACTGAGATTCCTTATGA
+CACATCTGAACACTAGTGGATTTGCTTTGTAGTAGGAACAAGGTACATTCGCGGGATAAATGTGGCCAA
+GTTTTATCTGCTGCCAGGGCTTTCAAATAGGTTGACCTGACAATGGGTCACCTCTGGGA
CTGA</Seq5>
                <Observed>C/T</Observed> 
                <Seq3>AATTAGGAAGAGCTGGTACCTAAAATGAAAGATGCCCTTAAATTTCAG
+ATTCACAATTTT</Seq3>

[download]
</Sequence>

In reply to Print XML elements and attributes by AhmedABdo

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.