I have a text file in fasta format, which looks like...

>SequenceID|1234_Gene1

ATGTGTGTGTGTGTGT (DNA Sequence)

>SequenceID|9876_Gene2

CTGTCGCTCGGAAAG (DNA Sequence)

I am trying to write a script that will pull this data from a txt file in the command line into a hash and then sort it by length. The hash would be set up as the SequenceID has the key and DNA sequence as the value.

This is what I have so far and it works, except I set up the hash inside the script and not from a txt file added in the command line, I am not sure how to do this. I do not want to use BioPerl. 

my %sequences = (
    "SequenceID|1234_Gene1"  => 'CTTTTAAGCTGATTAGGCTTTTATACCATTAGATTTA
+GTAACTATTGTCTTTTAA',
    "SequenceID|9876_Gene2"  => 'GTGCTGTCTTAAGTTGAACAGAGTGTGGGAGGAAATA
+TAAGCAAAGTTATTCCGTAGAATT',
    "SequenceID|4567_Gene3" => 'CATCCTCCTTTACACCCCACAAACATTTGGCAACCCCT
+GATAGGTTTCTTTCTTGTGGA', 
    
);

foreach my $key (keys %sequences)
{
  my $len = length ($sequences{$key});
  print "$key:$len\n";
}

[download]
Thank you

In reply to Creating hash from data extracted from text file in fasta format by reebee3

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.