G'day reebee3,

To read lines from a file on the command line, you can just do this:

while (<>) { # $_ holds the line read - process it here }

In your foreach loop, you can get each key in the sorted order you want by changing

... (keys ...

to

... (sort {length $sequences{$a} <=> length $sequences{$b} } keys ...

With this input file:

$ cat pm_1144803_fasta.txt >SequenceID|1234_Gene1 CTTTTAAGCTGATTAGGCTTTTATACCATTAGATTTAGTAACTATTGTCTTTTAA >SequenceID|9876_Gene2 GTGCTGTCTTAAGTTGAACAGAGTGTGGGAGGAAATATAAGCAAAGTTATTCCGTAGAATT >SequenceID|4567_Gene3 CATCCTCCTTTACACCCCACAAACATTTGGCAACCCCTGATAGGTTTCTTTCTTGTGGA

and this script:

$ cat pm_1144803_fasta_seq_len_sort.pl #!/usr/bin/env perl use strict; use warnings; my (%sequences, $seq_key); while (<>) { chomp; if (/^>/) { $seq_key = substr $_, 1; } else { $sequences{$seq_key} = $_; } } foreach my $key ( sort {length $sequences{$a} <=> length $sequences{$b} } keys %sequ +ences) { my $len = length ($sequences{$key}); print "$key:$len\n"; }

You can run this from the command line:

$ pm_1144803_fasta_seq_len_sort.pl pm_1144803_fasta.txt SequenceID|1234_Gene1:55 SequenceID|4567_Gene3:59 SequenceID|9876_Gene2:61

— Ken


In reply to Re: Creating hash from data extracted from text file in fasta format by kcott
in thread Creating hash from data extracted from text file in fasta format by reebee3

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.