comment on

To read lines from a file on the command line, you can just do this:

while (<>) {
    # $_ holds the line read - process it here
}
[download]

In your foreach loop, you can get each key in the sorted order you want by changing

... (keys ...
[download]

... (sort {length $sequences{$a} <=> length $sequences{$b} } keys ...
[download]

With this input file:

$ cat pm_1144803_fasta.txt
>SequenceID|1234_Gene1
CTTTTAAGCTGATTAGGCTTTTATACCATTAGATTTAGTAACTATTGTCTTTTAA
>SequenceID|9876_Gene2
GTGCTGTCTTAAGTTGAACAGAGTGTGGGAGGAAATATAAGCAAAGTTATTCCGTAGAATT
>SequenceID|4567_Gene3
CATCCTCCTTTACACCCCACAAACATTTGGCAACCCCTGATAGGTTTCTTTCTTGTGGA
[download]

and this script:

$ cat pm_1144803_fasta_seq_len_sort.pl
#!/usr/bin/env perl

use strict;
use warnings;

my (%sequences, $seq_key);

while (<>) {
    chomp;

    if (/^>/) {
        $seq_key = substr $_, 1;
    }
    else {
        $sequences{$seq_key} = $_;
    }
}

foreach my $key (
    sort {length $sequences{$a} <=> length $sequences{$b} } keys %sequ
+ences)
{
    my $len = length ($sequences{$key});
    print "$key:$len\n";
}
[download]

You can run this from the command line:

$ pm_1144803_fasta_seq_len_sort.pl pm_1144803_fasta.txt
SequenceID|1234_Gene1:55
SequenceID|4567_Gene3:59
SequenceID|9876_Gene2:61
[download]

— Ken

In reply to Re: Creating hash from data extracted from text file in fasta format by kcott
in thread Creating hash from data extracted from text file in fasta format by reebee3

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		`&`
	<		`<`
	>		`>`
	[		`[`
	]		`]`

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.