I would have organized the code slightly differently, factoring each of the pattern elements into a separate  qr// regex object and combining them together (inside a capture group) in the final  m// match:

c:\@Work\Perl\monks>perl -wMstrict -le
"my $codon = qr{ [ACGT]{3}       }xms;
 my $start = qr{ ATG             }xms;
 my $end   = qr{ TAG | TAA | TGA }xms;
 ;;
 my $seq = 'AATGGTTTCTCCCATCTCTCCATCGGCATAAAAATACAGAATGATCTAACGAA';
 ;;
 print qq{'$1'} while $seq =~ m{ ($start $codon*? $end) }xmsg;
"
'ATGGTTTCTCCCATCTCTCCATCGGCATAA'
'ATGATCTAA'
[download]

Separate  qr// definitions ease maintenance and, if variable names be wisely chosen, are self-commenting. If possible, I only use capture groups in the final  m// match due to the confusion that trying to count nested capture groups can produce.

---

---

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

• How do I compose an effective node title?
• How do I post a question effectively?
• Markup in the Monastery

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		&
	<		&lt;
	>		&gt;
	[		&#91;
	]		&#93;

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.