Hello nikkk. To answer your question, the problem is this line: $query = <>;. The diamond operator, <> opens a file supplied in the command line (contained in @ARGV, so $query now contains the first line from that file. There are 2 ways I can think of to avoid this.

First, you can change that line to $query = <STDIN>; and the program will read what you type in instead of doing the magic of reading from the file contained in @ARGV.

Second, you could empty the @ARGV array at the top of your program by saying $nomefile = shift @ARGV;. shift would remove the first (and in your case the only) filename from the command line and that would solve the problem when using the empty diamond <> operator later in the program.

Even though the second method would solve your problem, it is probably still better to use <STDIN> when reading a response from the command line anyway. That way, you will avoid any problems in your program.

I tried to understand what your program does and attempted to solve it using the Bio::SeqIO module which provides a good way to deal with fasta files. Documentation for BioPerl is here.

My example program and sample fasta data file are below.

Update: Changed program to process data as read (instead of storing to a data structure to process afterwards). 
#usr/bin/perl
use strict;
use warnings;
use Bio::SeqIO;

# 'shift' removes items from @ARGV
my $nomefile = shift;

print "Insert query:\n";
chomp(my $query = uc <STDIN>);

my $test = Bio::SeqIO->new( -file   => $nomefile,
                            -format => 'fasta');

print "\nResults for $nomefile\n\n";

while (my $seq = $test->next_seq()) {
    my @pos;
    
    my $id = $seq->id;
    my $fasta = uc $seq->seq;
    
    while ($fasta =~ /(?=$query)/g) {
        push @pos, $-[0] + 1;    
    }
    
    if (@pos) {
        printf "%s compare %d volte in posizione @pos with ID %s\n",
            $query, scalar @pos, $id;
    }
    else {
        print "$query does not appear in the sequence with ID $id\n"; 
+   
    }
}

[download]
The data file I tested with was: 
>chr1
AACCCCCCCCTCCCCCCGCTTCTGGCCACAGCACTTAAACACATCTCTGC
CAAACCCCAAAAACAAAGAACCCTAACACCAGCCTAACCAGATTTCAAAT
TTTATCTTTAGGCGGTATGCACTTTTAACAAAAAANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCCCATCCTACCCAGCACACACACACCGCTGCTAACCCCATACCCCGAAC
CAACCAAACCCCAAAGACACCCCCCACAGTTTATGTAGCTTACCTCNNNN
>chrM
GATCACAGGTCTATCACCCTATTAACCACTCACGGGAGCTCTCCATGCAT
TTGGTATTTTCGTCTGGGGGGTGTGCACGCGATAGCATTGCGAGACGCTG
GAGCCGGAGCACCCTATGTCGCAGTATCTGTCTTTGATTCCTGCCTCATT
CTATTATTTATCGCACCTACGTTCAATATTACAGGCGAACATACCTACTA
AAGTGTGTTAATTAATTAATGCTTGTAGGACATAATAATAACAATTGAAT
GTCTGCACAGCCGCTTTCCACACAGACATCATAACAAAANAATTTCCACC

[download]
Output I got from this sample data in response to the query was: 
Insert query:
tatt
TATT does not appear in the sequence with ID chr1
TATT    compare 5 volte  in posizione 20 55 152 155 177 with ID chrM

[download]

I hope this helps answer your question. If you don't understand some of the code I wrote, ask and I'll try to explain. There are probably some new things there that you may not have seen yet.

In reply to Re: Question: homemade blat: insert query from keyboard to find an oligo in an hashtable by Cristoforo
in thread Question: homemade blat: insert query from keyboard to find an oligo in an hashtable by nikkk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.