Perhaps this will help? (Sorry, I'm too lazy to use Bio::*):
#! perl -slw
use strict;
use Inline::Files;
use Data::Dump qw[ pp ];
my %seqs = map{ split "\n", $_ } <FASTA>;
pp \%seqs;
while( my( $seq, $pos, $chr, $rep ) = split ' ', <EDITS> ) {
substr( $seqs{ '>' . $seq }, $pos-1, 1, $rep );
}
pp \%seqs;
__FASTA__
>I
CATCAGTATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA
>II
TACCACAGATACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC
__EDITS__
I 2 A G
I 4 C T
I 5 A G
I 7 T C
II 1 T C
II 2 A G
II 3 C T
II 5 A C
II 8 G T
II 10 T G
Output:
C:\test>1158701
{
">I" => "CATCAGTATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA",
">II" => "TACCACAGATACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC",
}
{
">I" => "CGTTGGCATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA",
">II" => "CGTCCCATAGACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC",
}
With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
In the absence of evidence, opinion is indistinguishable from prejudice.
Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
Read Where should I post X? if you're not absolutely sure you're posting in the right place.
Please read these before you post! —
Posts may use any of the Perl Monks Approved HTML tags:
- a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
| |
For: |
|
Use: |
| & | | & |
| < | | < |
| > | | > |
| [ | | [ |
| ] | | ] |
Link using PerlMonks shortcuts! What shortcuts can I use for linking?
See Writeup Formatting Tips and other pages linked from there for more info.