Perhaps this will help? (Sorry, I'm too lazy to use Bio::*):

#! perl -slw use strict; use Inline::Files; use Data::Dump qw[ pp ]; my %seqs = map{ split "\n", $_ } <FASTA>; pp \%seqs; while( my( $seq, $pos, $chr, $rep ) = split ' ', <EDITS> ) { substr( $seqs{ '>' . $seq }, $pos-1, 1, $rep ); } pp \%seqs; __FASTA__ >I CATCAGTATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA >II TACCACAGATACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC __EDITS__ I 2 A G I 4 C T I 5 A G I 7 T C II 1 T C II 2 A G II 3 C T II 5 A C II 8 G T II 10 T G

Output:

C:\test>1158701 { ">I" => "CATCAGTATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA", ">II" => "TACCACAGATACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC", } { ">I" => "CGTTGGCATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA", ">II" => "CGTCCCATAGACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC", }

With the rise and rise of 'Social' network sites: 'Computers are making people easier to use everyday'
Examine what is said, not who speaks -- Silence betokens consent -- Love the truth but pardon error.
"Science is about questioning the status quo. Questioning authority". I knew I was on the right track :)
In the absence of evidence, opinion is indistinguishable from prejudice.

In reply to Re: Replacing substrings within hash values by BrowserUk
in thread Replacing substrings within hash values by K_Edw

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":



  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.