Since you can access a sequence using it's key, no need to loop through them until you need to print.
#!/usr/bin/env perl
use strict;
use warnings;
my %sequences = (
I => 'CATCAGTATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA',
II => 'TACCACAGATACGATACAACACATCAGTATAAAATGACTAGTAGCAGAC',
);
while (<DATA>) {
my @f = split(/\s+/, $_);
substr ($sequences{$f[0]},$f[1]-1,1) = $f[3];
}
print "CGTTGGCATAAAATGACTAGTAGCTAGATACCACAGATACGATACAACA\n";
for my $key (keys %sequences){
print $sequences{$key}."\n";
}
__DATA__
I 2 A G
I 4 C T
I 5 A G
I 7 T C
II 1 T C
II 2 A G
II 3 C T
II 5 A C
II 8 G T
II 10 T G
poj
Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
Read Where should I post X? if you're not absolutely sure you're posting in the right place.
Please read these before you post! —
Posts may use any of the Perl Monks Approved HTML tags:
- a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
| |
For: |
|
Use: |
| & | | & |
| < | | < |
| > | | > |
| [ | | [ |
| ] | | ] |
Link using PerlMonks shortcuts! What shortcuts can I use for linking?
See Writeup Formatting Tips and other pages linked from there for more info.