Seq1: TACATCTCAAAACACTTTCATCTCACGACTACTACTACTACTTCAAAACACCATCAT
Seq2: ACTTCAACATAACTACTATATACTACTCATACTACTACTCTTAAAACTACTATACTA

Seq1: TACATCTCAAAACACTTTCATCTCACGACTACTACTACTACTTCAAAACACCATCAT
Seq2: ACTTCAACATAACTACTATATACTACTCATACTACTACTCTTAAAACTACTATACTA

The above is the line1 and line2 from your sequence sample. The first shows in red and blue 2 matches from the regex.

In the second identical set, you can see (in red), a match which is 1 character longer than the longest match (in red, above).

My question is why the regex made 2 captures here instead of the optimal match in the second (10 chars instead of 9).

The code which accidentally found this was: 

my $xor = $file1contents ^ $file2contents;

my $max = 0;
my $max_str;
my $pos;
while ($xor =~ /(\0+)/g) {
    my $len = length $1;
    if ($len > $max) {
        $max = $len;
        $max_str = substr $file1contents, $-[0], $len;
        $pos = $-[0];
    }
    #print "matched $-[0] ", substr $file1contents, $-[0], $+[0] - $-[
+0];
}

print "at pos $pos max string is $max_str";

[download]

In reply to Re^2: FInding the longest match from an initial match between two files by Cristoforo
in thread FInding the longest match from an initial match between two files by Allie_grater

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.