I need to use regex and select the values of the "AC" line, "OS" line, "OX" line, "ID" line, "GN" line, "SQ" line and construct the fasta format which should look like this. The first line of the fasta format consists of the values from the line headings parsed from the uniprot file and are separated by "|". Here is an example of a fasta file:ID ARF1_PLAFA Reviewed; 181 AA. AC Q94650; O02502; O02593; DT 15-JUL-1998, integrated into UniProtKB/Swiss-Prot. DT 23-JAN-2007, sequence version 3. DT 25-NOV-2008, entry version 52. DE RecName: Full=ADP-ribosylation factor 1; GN Name=ARF1; Synonyms=ARF, PLARF; OS Plasmodium falciparum. OC Eukaryota; Alveolata; Apicomplexa; Aconoidasida; Haemosporida; OC Plasmodium; Plasmodium (Laverania). OX NCBI_TaxID=5833; RN [1] RP NUCLEOTIDE SEQUENCE [GENOMIC DNA]. RC STRAIN=T9/96; TISSUE=Blood; RX MEDLINE=97112480; PubMed=8954160; RX DOI=10.1111/j.1432-1033.1996.0104r.x; RA Stafford W.H., Stockley R.W., Ludbrook S.B., Holder A.A.; RT "Isolation, expression and characterization of the gene for an AD +P- RT ribosylation factor from the human malaria parasite, Plasmodium RT falciparum."; RL Eur. J. Biochem. 242:104-113(1996). RN [2] RP NUCLEOTIDE SEQUENCE [MRNA]. RX MEDLINE=97237566; PubMed=9084044; DOI=10.1016/S0166-6851(96)02803 +-4; RA Truong R.M., Francis S.E., Chakrabarti D., Goldberg D.E.; RT "Cloning and characterization of Plasmodium falciparum ADP- RT ribosylation factor and factor-like genes."; RL Mol. Biochem. Parasitol. 84:247-253(1997). CC -!- FUNCTION: GTP-binding protein that functions as an allosteric CC activator of the cholera toxin catalytic subunit, an ADP- CC ribosyltransferase. Involved in protein trafficking; may modu +late CC vesicle budding and uncoating within the Golgi apparatus (By CC similarity). CC -!- SUBCELLULAR LOCATION: Golgi apparatus (By similarity). CC -!- SIMILARITY: Belongs to the small GTPase superfamily. Arf fami +ly. CC ----------------------------------------------------------------- +------ CC Copyrighted by the UniProt Consortium, see http://www.uniprot.org +/terms CC Distributed under the Creative Commons Attribution-NoDerivs Licen +se CC ----------------------------------------------------------------- +------ DR EMBL; Z80359; CAB02498.1; -; Genomic_DNA. DR EMBL; U57370; AAB63304.1; -; mRNA. DR HSSP; P32889; 1RRF. DR SMR; Q94650; 6-179. DR GO; GO:0005794; C:Golgi apparatus; IEA:UniProtKB-KW. DR GO; GO:0005525; F:GTP binding; IEA:InterPro. DR GO; GO:0015031; P:protein transport; IEA:UniProtKB-KW. DR GO; GO:0007264; P:small GTPase mediated signal transduction; IEA: +InterPro. DR GO; GO:0016192; P:vesicle-mediated transport; IEA:UniProtKB-KW. DR InterPro; IPR006688; ARF. DR InterPro; IPR006689; ARF/SAR. DR InterPro; IPR001806; Ras_trnsfrmng. DR InterPro; IPR005225; Small_GTP_bd. DR PANTHER; PTHR11711; ARF/SAR; 1. DR Pfam; PF00025; Arf; 1. DR PRINTS; PR00449; RASTRNSFRMNG. DR PRINTS; PR00328; SAR1GTPBP. DR SMART; SM00177; ARF; 1. DR TIGRFAMs; TIGR00231; small_GTP; 1. DR PROSITE; PS01019; ARF; 1. PE 2: Evidence at transcript level; KW ER-Golgi transport; Golgi apparatus; GTP-binding; Lipoprotein; KW Myristate; Nucleotide-binding; Protein transport; Transport. FT INIT_MET 1 1 Removed (Potential). FT CHAIN 2 181 ADP-ribosylation factor 1. FT /FTId=PRO_0000207447. FT NP_BIND 24 31 GTP (By similarity). FT NP_BIND 67 71 GTP (By similarity). FT NP_BIND 126 129 GTP (By similarity). FT LIPID 2 2 N-myristoyl glycine (Potential). SQ SEQUENCE 181 AA; 20912 MW; 18013B069BEA2413 CRC64; MGLYVSRLFN RLFQKKDVRI LMVGLDAAGK TTILYKVKLG EVVTTIPTIG FNVETVEFRN ISFTVWDVGG QDKIRPLWRH YYSNTDGLIF VVDSNDRERI DDAREELHRM INEEELKDAI ILVFANKQDL PNAMSAAEVT EKLHLNTIRE RNWFIQSTCA TRGDGLYEGF DWLTTHLNNA K
some code I have so far:>NM_012514 | Rattus norvegicus | breast cancer 1 (Brca1) | mRNA CGCTGGTGCAACTCGAAGACCTATCTCCTTCCCGGGGGGGCTTCTCCGGCATTTAGGCCT CGGCGTTTGGAAGTACGGAGGTTTTTCTCGGAAGAAAGTTCACTGGAAGTGGAAGAAATG GATTTATCTGCTGTTCGAATTCAAGAAGTACAAAATGTCCTTCATGCTATGCAGAAAATC TTGGAGTGTCCAATCTGTTTGGAACTGATCAAAGAACCGGTTTCCACACAGTGCGACCAC ATATTTTGCAAATTTTGTATGCTGAAACTCCTTAACCAGAAGAAAGGACCTTCCCAGTGT CCTTTGTGTAAGAATGAGATAACCAAAAGGAGCCTACAAGGAAGTGCAAGG
I just printed $1, $2, $3, $4, and $5 just to see if i was able to capture the values that the regex matched. However I keep getting this output when I try printing:#!/usr/bin/perl use warnings; use strict; unless (open(UNIPROT, "<", "uniprotfile")) { die "Unable to open uniprot file", $!; } while (<UNIPROT>) { my $lines = $_; if ($lines =~ /^AC\s+(.*)\;|^OS\s+(.*)|^OX\s+(.*)|^ID\s+(.*)|^GN\s+(. +*)/) print $1, $2, $3, $4, $5, "\n"; }
I'm not exactly sure where i'm making the mistake..does the "or |" part mess up the loop? Thank you for your help!Use of uninitialized value $1 in print at ./file.pl line 11, <UNIPROT> + line 1. Use of uninitialized value $2 in print at ./file.pl line 11, <UNIPROT> + line 1. Use of uninitialized value $3 in print at ./file.pl line 11, <UNIPROT> + line 1. Use of uninitialized value $5 in print at ./file.pl line 11, <UNIPROT> + line 1. CERU_HUMAN STANDARD; PRT; 1065 AA. Use of uninitialized value $2 in print at ./file.pl line 11, <UNIPROT> + line 2. Use of uninitialized value $3 in print at ./file.pl line 11, <UNIPROT> + line 2. Use of uninitialized value $4 in print at ./file.pl line 11, <UNIPROT> + line 2. Use of uninitialized value $5 in print at ./file.pl line 11, <UNIPROT> + line 2. P00450; Q14063 Use of uninitialized value $1 in print at ./file.pl line 11, <UNIPROT> + line 7. Use of uninitialized value $2 in print at ./file.pl line 11, <UNIPROT> + line 7. Use of uninitialized value $3 in print at ./file.pl line 11, <UNIPROT> + line 7. Use of uninitialized value $4 in print at ./file.pl line 11, <UNIPROT> + line 7. CP. Use of uninitialized value $1 in print at ./file.pl line 11, <UNIPROT> + line 8. Use of uninitialized value $3 in print at ./file.pl line 11, <UNIPROT> + line 8. Use of uninitialized value $4 in print at ./file.pl line 11, <UNIPROT> + line 8. Use of uninitialized value $5 in print at ./file.pl line 11, <UNIPROT> + line 8. Homo sapiens (Human). Use of uninitialized value $1 in print at ./file.pl line 11, <UNIPROT> + line 11. Use of uninitialized value $2 in print at ./file.pl line 11, <UNIPROT> + line 11. Use of uninitialized value $4 in print at ./file.pl line 11, <UNIPROT> + line 11. Use of uninitialized value $5 in print at ./file.pl line 11, <UNIPROT> + line 11. NCBI_TaxID=9606;
In reply to Converting Uniprot File to a Fasta File in Perl by pearllearner315
| For: | Use: | ||
| & | & | ||
| < | < | ||
| > | > | ||
| [ | [ | ||
| ] | ] |