hi poj! thank you so much for your help! could you explain what the flag is actually doing? i'm reading the code and i'm having difficulty understanding. also what is Dumper? i'm trying to format my code so that I can get this type of output once i parse the headers and sequence: 
 >NM_012514 | Rattus norvegicus | breast cancer 1 (Brca1) | mRNA
 CGCTGGTGCAACTCGAAGACCTATCTCCTTCCCGGGGGGGCTTCTCCGGCATTTAGGCCT
 CGGCGTTTGGAAGTACGGAGGTTTTTCTCGGAAGAAAGTTCACTGGAAGTGGAAGAAATG
 GATTTATCTGCTGTTCGAATTCAAGAAGTACAAAATGTCCTTCATGCTATGCAGAAAATC
 TTGGAGTGTCCAATCTGTTTGGAACTGATCAAAGAACCGGTTTCCACACAGTGCGACCAC
 ATATTTTGCAAATTTTGTATGCTGAAACTCCTTAACCAGAAGAAAGGACCTTCCCAGTGT
 CCTTTGTGTAAGAATGAGATAACCAAAAGGAGCCTACAAGGAAGTGCAAGG

[download]

In reply to Re^4: Converting Uniprot File to a Fasta File in Perl by pearllearner315
in thread Converting Uniprot File to a Fasta File in Perl by pearllearner315

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.