I have a file which contains several 100s of fasta sequences in the form as such: 
>hsa_circ_0000001|chr1:1080738-1080845-|None|None
ATGGGGTTGGGTCAGCCGTGCGGTCAGGTCAGGTCGGCCATGAGGTCAGGTGGGGTCGGCCATGAAGGTG
+GTGGGGGTCATGAGGTCACAAGGGGGTCGGCCATGTG
>hsa_circ_0000002|chr1:1158623-1159348-|NM_016176|SDF4
GGTGGATGTGAACACTGACCGGAAGATCAGTGCCAAGGAGATGCAGCGCTGGATCATGGAGAAGACGGCC
+GAGCACTTCCAGGAGGCCATGGAGGAGAGCAAGACACACTTCCGCGCCGTGGACCCTGACGGGGACGGT
+CACGTGTCTTGGGACGAGTATAAGGTGAAGTTTTTGGCGAGTAAAGGCCATAGCGAGAAGGAGGTTGCC
+GACGCCATCAGGCTCAACGAGGAACTCAAAGTGGATGAGGAAA

[download]
I wrote a script that counts the sequence length (bases) in each sequence and creates a file containing them all, but the problem is that it also adds the new line character into the count making it count+1. Is there a way to -1 from the count in order to obtain the true count of the sequence length? My script is as follows: 
my $filename = 'counts.txt';
open (my $fh, '>', $filename) or die "Could not open '$filename' $!";

my $count = "";

while (my $line = <>){
    if ($line =~ /^>hsa/){
        $line = <>;
        $count .= length$line;
        $count .= " ";
    }
}

print $fh $count;
close $fh;

[download]

In reply to How to amend character count. by Peter Keystrokes

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.