Ok, so it looks like the rules are:

• ATG can be be a start codon, or it can code for Methionine.
• * TAG, TAA, and TGA are always end codons.
• * A paired start and end have to be separated by a multiple of three bases.

Here's a one-pass solution:

my @start = ([],[],[]);
my $sequence = 'ATGATGAATGAATAGTAGATAG';
for my $i (0 .. length($sequence)-3) {
   my $triplet = substr($sequence, $i, 3);
   if ($triplet eq 'ATG') {
      push @{$start[$i%3]}, $i;
   }
   elsif ($triplet eq 'TAG' || $triplet eq 'TAA' || $triplet eq 'TGA')
+ {
      for my $j (@{$start[$i%3]}) {
         print $j, '..', $i+2, "\n";
      }
      @{$start[$i%3]} = ();
   }
}
[download]

Output:

0..14
3..14
7..21
[download]

Explanation of the output:

ATGATGAATGAATAGTAGATAG
STA123123123END
   STA123123END
       STA123123123END
[download]

---

---

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

• How do I compose an effective node title?
• How do I post a question effectively?
• Markup in the Monastery

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		&
	<		&lt;
	>		&gt;
	[		&#91;
	]		&#93;

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.