Hi there,

I have a script which extracts sequences from a file containing thousands of fasta sequences and creates separate files for each of them.

Here is my script:

#!/usr/bin/perl 
use strict;
use warnings;

my %id2seq = ();
my $id = '';

open File,"human_hg19_circRNAs_putative_spliced_sequence.fa",or die $!
+;

    while(<File>){
        chomp;
        if($_ =~ /^>(.+)/){
            $id = $1;
        }else{
            $id2seq{$id} .= $_;
        }
    }

 

    foreach $id (keys %id2seq){
        if (-f $id){
            print $id." Already exists, about to override it","\n"
        }
        open  my $out_fh, '>>', "$id.fa" or die $!; 
        print $out_fh (">".$id."\n",$id2seq{$id}, "\n");
        close $out_fh;
    }


close File;

[download]

Now, the human_hg19_circRNAs_putative_spliced_sequence.fa file which I am working on contains sequences as such:

>hsa_circ_0000001|chr1:1080738-1080845-|None|None

ATGGGGTTGGGTCAGCCGTGCGGTCAGGTCAGGTCGGCCATGAGGTCAGGTGGGGTCGGCCATGAAGGTGGTGGGGGTCATGAGGTCACAAGGGGGTCGGCCATGTG

My script captures each sequence header as the key of a hash and captures the sequence itself as the hash. But the problem is that I want to name the files with only a part of the $id and not the whole of it i.e. hsa_circ_0000001.

Is there a simple way to do this? Or do I have to create a new hash to extract filenames?

Pete.

In reply to An overlapping regex capture by Peter Keystrokes

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.