Assalam o alaikum everyone,

I am working with multiple genes and in each gene folder i have multiple FASTA (70-75) files and each FASTA file contains single gene sequence. e.g.

AMY2b_Gene_folder

Chimpanzee_AMY2B_CDS.fasta
Human_AMY2B_CDS.fasta
Pygmy_chimpanzee_AMY2B_CDS.fasta
Western_gorrila_AMY2B_CDS.fasta

[download]

cat Chimpanzee_AMY2B_CDS.fasta

 >lcl|NM_020978.4_cds_NP_066188.1_1 [gene=AMY2B] [protein=alpha-amylas
+e 2B precursor] [protein_id=NP_066188.1] [location=673..2208]
ATGAAGTTCTTTCTGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCCCAAATACACAACAAG
+GACGGACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATATT
+TAGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCAATTCACAACCCTT
+TC

[download]

cat Human_AMY2B_CDS.fasta

 >lcl|NM_020978.4_cds_NP_066188.1_1 [gene=AMY2B] [protein=alpha-amylas
+e 2B precursor] [protein_id=NP_066188.1] [location=673..2208]
ATGAAGTTCTTTCTGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCCCAAATACACAACAAG
+GACGGACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATATT
+TAGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCAATTCACAACCCTT
+TC

[download]

I want to change headers of each fasta file according to a specific order given in text file.

cat Headers.txt
MP.C_AMY2B
FP.H_AMY2B

[download]

Desired output should be look like

 >MP.C_AMY2B
 ATGAAGTTCTTTCTGTTGCTTTTCACCATTGGGTTCTGCTGGGCTCAGTATTCCCCAAATACACAACAA
+G GACGGACATCTATTGTTCATCTGTTTGAATGGCGATGGGTTGATATTGCTCTTGAATGTGAGCGATA
+TTT AGCTCCCAAGGGATTTGGAGGGGTTCAGGTCTCTCCACCAAATGAAAATGTTGCAATTCACAACC
+CTTTC

[download]

Kindly guide me is there any command-line solution to do so(which work for multiple FASTA files which have single gene sequence)????

2017-09-16 Athanasius added code tags

In reply to Command or Perl script for changing headers of multiple FASTA files in a specific order listed in a txt file by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.