I currently load a FASTA formatted file, which contains DNA sequence separated by headers denoted by '>' i.e.:

>header1
AGACATGATCGACTGGACACAATTTACGTAGCTG
>header2
AAATACTAGGGCAACACACACACACACCACACAC
>header3
AGTTAGTCCAGTAGTTTACAGTACGACTGATCGT

[download]

via bioPerl (Bio::SeqIO), and store the entire FASTA file into memory as a hash:

my $fasta = $ARGV[0];
my $seqio = Bio::SeqIO->new(-file => $fasta);
while(my $seqobj = $seqio->next_seq) {
    my $id  = $seqobj->display_id;
    my $seq = $seqobj->seq;
    $sequences{$id} = $seq;
}
open my $IN2, '<', $ARGV[1] or die "$!";
while (<$IN2>) {
    # Subsample the FASTA sequences
}

[download]

Or I could code it manually (which is likely quicker given the amount of overhead in Bio::SeqIO).

Based on a second input file, I then subsample the FASTA sequences and do some processing.

Each line of $IN2 includes the header from its associated FASTA sequence.

This works fine, and on modern computers the memory usage isn't too much of a problem even with larger genomes (Human etc.). Nevertheless, i'd like to take advantage of the fact that my second input file ($IN2) is always sorted by header and thus, for example, the first 5000 lines of it only need the FASTA sequence from >header1. This could potentially save me having to load the entire FASTA file into memory and instead only load the sequence that is currently being used.

I'm however having a tough time trying to figure out how to actually do this so any suggestions or code would be greatly appreciated.

In reply to Loading only portions of a file at any given time by TJCooper

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.