Hello. I started learning perl two weeks ago and I have a practice assignment to convert fasta files into tabular format using perl. I managed to write a program that converted a fasta into tbl but only when there is one sequence in the fasta file. If I have multiple sequences in a fasta file, I cannot manage to convert them to tbl properly. This is the code I wrote that works with one sequence in the fasta: 

 
#!/usr/bin/perl
# fasta_to_tbl.pl
use strict; use warnings;

die "Please specify suitable file\n" if (@ARGV != 1);
my ($fasta) = @ARGV;

my $outfile = "$fasta.tbl";

open(my $in, "<", "$fasta")
  or die "error reading $fasta. $!";
open(my $out, ">", "$outfile")
  or die "error creating $outfile. $!";

my $identifier = "";
my $union = "";
while (<$in>) {
  chomp;
  next unless m/\w/;
  if ($_ =~ m/>/) {
    # Identifier!
    $_ =~ s/>//;
    ($identifier) = split /\:|\s|\||,|;/, $_;
    print "$identifier\n";
  } else {
    # We have a line with sequence
    $union = $union . $_;
  }
}
print $out "$identifier\t$union\n";

close($in);
close($out);

[download]

I realized that it would be a lot better to use hashes instead of arrays to separate the different sequences. I want to have the sequence title/name be the key and the sequence be the value. I also thought it would be good to use the local command so that I can separate based on ">" symbol instead of by line because all fasta file titles start with that symbol. I am stuck on actually implementing those realizations and then using a loop to edit the formatting for each sequence. Any suggestions? Thank you in advance!

I am using the simple fasta file below for practice but do note that many fasta files contain extra information in the title and may have a space between the title and the sequence. We only want the name in tbl and not the extra information. The code above takes care of those extras only for one sequence.

Fasta format 

>sequence1
ACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGTCTCGCAGCCGCAGCCCGCGTGG
ACGCTCTCGCCTGAGCGCCGCGGACTAGCCCGGGTGGCC

>sequence2
CAGTCCGGCAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCCGGAGATTCGCGA
ACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCGGCGCGATCGCGGCGCCGCGCTACAGCCAGCCT
CACTGGCGCGCGGGCGAGCGCACGGGCGCTC

>sequence3
CACGACAGGCCCGCTGAGGCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGGAT
CTCCCCTCCCC

>sequence4
CAGCAGACATCTGAATGAAGAAGAGGGTGCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTC
AGTGACCAGTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCTGCACAGAGCCAG
TCTGCACACC

[download]

Tabular format 

>sequence1   ACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGTCTCGCAGCC
+GCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAGCCCGGGTGGCC

>sequence2   CAGTCCGGCAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGC
+CGGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCGGCGCGATCGCGGCGCCGC
+GCTACAGCCAGCCTCACTGGCGCGCGGGCGAGCGCACGGGCGCTC

>sequence3   CACGACAGGCCCGCTGAGGCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTT
+CCAGACGCGGGATCTCCCCTCCCC

>sequence4   CAGCAGACATCTGAATGAAGAAGAGGGTGCCAGCGGGTATGAGGAGTGCATTATCGT
+TAATGGGAACTTCAGTGACCAGTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAAT
+CTGCACAGAGCCAGTCTGCACACC

[download]

In reply to Converting fasta (with multiple sequences) into tabular using perl by rarenas

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.