Here is another technique for your toolbox. I don't see the need to separate the identifier or create $union. 
#!/usr/bin/perl
use strict;
use warnings;


while (my $line = <DATA>)
{
    process_record($line) if $line=~ /^>/;
}

sub process_record
{
    my $line = shift;
    $line =~ s/\s*$//;  #or chomp $line
    print "$line\t";
    
    while (defined ($line=<DATA>) and $line !~ /^\s*$/)
    {
        $line =~ s/\s*$//;  #or chomp $line
        print $line;
    }
    print "\n";
}

=Prints:
>sequence1    ACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGTCTCGCAGC
+CGCAGCCCGCGTGGACGCTCTCGCCTGAGCGCCGCGGACTAGCCCGGGTGGCC
>sequence2    CAGTCCGGCAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCG
+CCGGAGATTCGCGAACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCGGCGCGATCGCGGCGCCG
+CGCTACAGCCAGCCTCACTGGCGCGCGGGCGAGCGCACGGGCGCTC
>sequence3    CACGACAGGCCCGCTGAGGCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTT
+TCCAGACGCGGGATCTCCCCTCCCC
>sequence4    CAGCAGACATCTGAATGAAGAAGAGGGTGCCAGCGGGTATGAGGAGTGCATTATCG
+TTAATGGGAACTTCAGTGACCAGTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAA
+TCTGCACAGAGCCAGTCTGCACACC
=cut



__DATA__
>sequence1
ACTCCCCGTGCGCGCCCGGCCCGTAGCGTCCTCGTCGCCGCCCCTCGTCTCGCAGCCGCAGCCCGCGTGG
ACGCTCTCGCCTGAGCGCCGCGGACTAGCCCGGGTGGCC

>sequence2
CAGTCCGGCAGCGCCGGGGTTAAGCGGCCCAAGTAAACGTAGCGCAGCGATCGGCGCCGGAGATTCGCGA
ACCCGACACTCCGCGCCGCCCGCCGGCCAGGACCCGCGGCGCGATCGCGGCGCCGCGCTACAGCCAGCCT
CACTGGCGCGCGGGCGAGCGCACGGGCGCTC

>sequence3
CACGACAGGCCCGCTGAGGCTTGTGCCAGACCTTGGAAACCTCAGGTATATACCTTTCCAGACGCGGGAT
CTCCCCTCCCC

>sequence4
CAGCAGACATCTGAATGAAGAAGAGGGTGCCAGCGGGTATGAGGAGTGCATTATCGTTAATGGGAACTTC
AGTGACCAGTCCTCAGACACGAAGGATGCTCCCTCACCCCCAGTCTTGGAGGCAATCTGCACAGAGCCAG
TCTGCACACC

[download]
Update:
I missed the idea that there could be some "kruft" after the id because an example of that was not present in the example data provided. I would recommend something like this change to process_record(): 
    (my $id) = $line =~ /^(>\w+)/;  #allow for kruft after id
    print "$id\t";

[download]
In general, use a regex when you know what you want to extract. Use a split when you know what you want to throw away. With the above regex, it is not necessary to enumerate all of these potential non-word things like "|;(space)", etc. However, note that underscore "_" is a "word character" (any character valid in a Perl variable name is allowed for \w). If underscore could directly follow the sequence id, then of course the regex would need to change. However, I see no evidence that would be necessary.

In reply to Re: Converting fasta (with multiple sequences) into tabular using perl by Marshall
in thread Converting fasta (with multiple sequences) into tabular using perl by rarenas

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.