My best guess at what you are trying to do

#!/usr/bin/perl
use strict;
# quality trimming of fastq file  

print "Write the window length\n";
my $kmer = 3;#<STDIN>;
chomp ($kmer);

print "Write the minimum quality score cut-off\n";
my $cut_off = 21;#<STDIN>;
chomp ($cut_off);

my $file = "lib-pool-fosmid.fastq";
open FASTQ,'<',$file or die "Could not open $file : $!";
open OUT,'>','trimmed_'.$file;
 
my @seq = ();
while (my $header1 = <FASTQ>){ 
  
  # input 4 line records
  my @rec = ();
  $rec[0] = $header1;
  do  { $rec[$_] = <FASTQ> } for (1..3);
  chomp(@rec);
  
  # process
  @rec = trim(@rec);
  
  # output
  print "\nOutput written to 'trimmed_$file'\n";
  print "$_\n" for @rec;
  print OUT "$_\n" for @rec;
}


# trim
sub trim {
  my @rec = @_;
  my @dna  = split '', $rec[1]; 
  my @qual = split '', $rec[3]; 
  my @score = map{ ord($_)-33 } @qual;  
  
  # lower quality from start 
  my $start = 0;
  for (@score){
    last if ($_ >= $cut_off);
    ++$start; 
  }  
  
  # lower quality from end 
  my $end   = @qual -1;
  for (reverse @score){
    last if ($_ >= $cut_off);
    --$end; 
  }
  print "Start=$start  End=$end\n";
  
  # trim
  @dna   = @dna[$start..$end];
  @qual  = @qual[$start..$end];
  @score = @score[$start..$end];
  print "Trimmed ".join '',@dna,"\n";

  # check each window
  print "\nWindows\n";
  my @final_dna;
  my @final_qual;

  while (@dna > 0){
    my @dna1   = splice @dna,0,$kmer;
    my @qual1  = splice @qual,0,$kmer;
    my @score1 = splice @score,0,$kmer;
    my $sum = 0;
    $sum += $_ for @score1;
    my $avg = $sum/@score1;
    
    print "@dna1 | @qual1 | @score1 | Sum=$sum Avg=$avg\n";
    
    if ($avg > $cut_off){
      push @final_dna,@dna1;
      push @final_qual,@qual1;
    }
  }
  
  $rec[1] = join '',@final_dna;
  $rec[3] = join '',@final_qual;
  return @rec;
}

__DATA__
@SEQ_ID
GATTTGGGGTTCAAAGCAGTATCGATCAAATAGTAAATCCATTTGTTCAACTCACAGTTT
+
!''*((((***+))%%%++)(%%%%).1***-+*''))**55CCF>>>>>>CCCCCCC65
[download]

update : corrected output
poj

---

---

Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!

Titles consisting of a single word are discouraged, and in most cases are disallowed outright.

Read Where should I post X? if you're not absolutely sure you're posting in the right place.

Please read these before you post! —

• How do I compose an effective node title?
• How do I post a question effectively?
• Markup in the Monastery

Posts may use any of the Perl Monks Approved HTML tags:

a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr

You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)

	For:		Use:
	&		&
	<		&lt;
	>		&gt;
	[		&#91;
	]		&#93;

Link using PerlMonks shortcuts! What shortcuts can I use for linking?

See Writeup Formatting Tips and other pages linked from there for more info.