If I fix your regular expression (see perlretut), then note that $tmp1[0] =~ /\Q$tmp2[0]\E/ means "is the string $tmp2[0] contained in $tmp1[0]?". However, just as an example, $tmp1[0] may be "ATCCCACCGCTGCCACCA", while $tmp2[0] may be "AACCCCATCCCACCGCTGCCACCA" - so as you might be able to tell, you've got your condition reversed. Some better variable naming would really help here!

You haven't shown your expected output, so I can't give any advice there other than to have a look at How do I post a question effectively?, SSCCE, and I know what I mean. Why don't you?

A few general tips: Use strict and warnings (you've been told this twice before), and use the newer, three-argument form of open and lexical filehandles, as in open(my $infh1, '<', $filename) or die "Cannot open $filename: $!";

Update: By the way, you could build a single regex out of all of the search strings - I wrote a tutorial on this at Building Regex Alternations Dynamically.

In reply to Re: finding sequence by haukex
in thread finding sequence by yueli711

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.