As an example:

Input of first line: acggaccgcggcatttgccaatttgcgcgtcgtcgggggtcgccatgatgtttcgcttggcaggcttttttgctttggcactgctggtcgcgggaaagcc

Output of first line: ACGGACCGCGGCATTTGCCAATTTGCGCGTCGTCGGGGGTCGCCATGATGTTTCGCTTGGCAGGCTTTTTTGCTTTGGCA

So the sequence: ctgctggtcgcgggaaagcc is completely gone from my output. Interestingly, the output is 80 chars while the input is 100, so the missing chunk is exactly 20. Is Perl somehow limited to only 80 chars in a line of text?

In reply to Re^2: missing character when reading input file by JediGorf
in thread missing character when reading input file by JediGorf

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.