No leading whitespaces anywhere in input file. I just opened it with a text editor and checked

But I just remembered that real life DNA sequences also often have N in addition to A/T/G/C. these have to be accounted for as well, right?

However, in my input sequences, having Ns versus NOT having them did not appear to make a difference in my test runs using the following input example 

>Chr1
CCCTAAACCCTAAACCCTAAACCCTAAACCTCTGAATCCTTAATCCCTAAATCCCTAAAT
>Chr2
TATGACGTTTAGGGACGATCTTAATGACGTTTAGGGTTTTATCGATCAGCGACGTAGGGA
>Chr3
GTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTTAGGGTTT
>Chr4
AACAAGGTACTCTCATCTCTTTACTGGGTAAATAACATATCAACTTGGACCTCATTCATA
>Chr5
AACATGATTCACACCTTGATGATGTTTTTAGAGAGTTCTCGTGTGAGGCGATTCTTGAGG

[download]

It'd be strange if it worked for you, because it is not working for me! Output file is always empty - whether it be with large file size, real-life input sequences, or small example ones like above, Or with or without N characters, in addition to the A, C, G, T

For example above, I even changed window length to 10

I'm not sure what is happening! Perhaps you can share the code that works with this example (script version using in and out file handles)

Sorry for the bother, but thanks

In reply to Re^8: Reduce RAM required by onlyIDleft
in thread Reduce RAM required by onlyIDleft

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.