I am trying to catch matches in a DNA sequence. I can capture repeating G (10 or more) in DNA as below. 

use 5.18.2;
my $line;
while (<DATA>){
    $line = $_;
    if ($line =~ m/(G)\1{9,}/) {
       say "$&"
    }
}

__DATA__
GGCTTTCCGTTGTTGCTGGGTGTGGGGGGCGGGCGAGATTGGAAGAGCACACGTCTGAACTCCAGTCACG
+CCAATATCTCGTATGCCGTCTTCTGCTTGAAAAAAGGGGTGGGGGGGAGGGGGGGCGGGGGGGGGGGGG
+GGAGGGGGGGAG

[download]

What I want to capture more is below. In addition to 10 G, I also want to capture strings at the left of (G)\1{9,}. Note I use " " to indicate what I want to capture; it's not a part of the DNA string. I could not capture the other parts of the string in conjunction with (G)\1{9,}. I need to print what I capture.

 "ACTCCAGTCACGCCAATATCTCGTAT"  "[ACTG]{0,10}"  " .+"  "(G)\1{9,}   ".+ "

Thanks.

In reply to help with regex by rnaeye

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.