In this case, it appears that yes, move(n,m) is the only operation with cost. (I'm not sure if it's cost is constant over all n,m. I think we're supposted to assume that it is.)

In purticular, this is going to be applied to a tape-library servicing robot, which only has one operation: switch the tapes in positions N and M. (move(n,m))

You're right about bubble-sort being a possiblity... but I don't think it's a good one. Remember that it isn't finding the sequence of moves that has to be done in constant space, it's the acautual movement of physical tapes.

TACCTGTTTGAGTGTAACAATCATTCGCTCGGTGTATCCATCTTTG ACACAATGAATCTTTGACTCGAACAATCGTTCGGTCGCTCCGACGC

In reply to Re: Re: sort with fewest moves by theorbtwo
in thread sort with fewest moves by axelrose

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.