After tinkering about for a while trying to make a pattern match produce sensible results, I stepped back and tried to think of the problem at core. What you really want to find is a "longest common subsequence" between the strings. There's a very good module on CPAN which does just this - Algorith::Diff. 
#!/usr/bin/perl -w
use strict;

use Algorithm::Diff qw(traverse_sequences);

# construct arrayrefs containing an array of single chars
my ($A, $B) = map [/(.)/sg], qw(
    ATGGAGTCGACGAATTTGAAGAAT
    xxxxxxATGGAGyxxxTCGAzxxxxCGAATTTGAAxxwGAAT
);

my $prev = '';
my @seq;

traverse_sequences(
    $A, $B,
    {
        MATCH => sub {
            my ($aidx, $bidx) = @_;
            if('=' ne $prev) {
                push @seq, '';
                $prev = '=';
            }
            $seq[-1] .= $A->[$aidx];
        },
        DISCARD_A => sub { die "Sequence in A is not fully contained i
+n B" },
        DISCARD_B  => sub {
            my ($aidx, $bidx) = @_;
            if('!' ne $prev) {
                push @seq, '';
                $prev = '!';
            }
            $seq[-1] .= $B->[$bidx];
        },
    },
);

print "@seq\n";

__END__
xxxxxx ATGGAG yxxx TCGA zxxxx CGAATTTGAA xxw GAAT

[download]
Even this falls short on "actual" data though: working against GATAGCATGGAGGCCATCGATAACGCGAATTTGAATTTGAAT it produces G AT A G CAT G G AG GCCA TCGA TAA CG CG AATTTGAA TTT GAAT..

Makeshifts last the longest.

In reply to Re: Complicated pattern match by Aristotle
in thread Complicated pattern match by dr_jgbn

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.