You may want to have a look at Algorithms on Strings, Trees, and Sequences: Computer Science and Computational Biology, although I haven't got a copy on my desk right now, I'm pretty sure some nice algorithm for this problem is given. Time Warps, String Edits, and Macromolecules: The Theory and Practice of Sequence Comparison might also be worth a try.

Nevertheless I had a go at it, the code is shown below.

Just my 2 cents, -gjb-

use strict;
use warnings;

$a = 'ATGGAGTCGACGAATTTGAAGAAT';
$b = 'xxxxxxATGGAGyxxxTCGAzxxxxCGAATTTGAAxxwGAAT';

my $prevPos = 0;
my $reA = createRegex($a);
while ($b =~ /$reA/g) {
    my $match = $&;
    my $skipped = substr($`, $prevPos);
    print "[$skipped]\n";
    $a = substr($a, length($match));
    last if length($a) == 0;
    $prevPos = pos($b);
    $reA = createRegex($a);
}

sub createRegex {
    my ($str) = @_;
    my @chars = split(//, $str);
    my $firstChar = shift(@chars);
    my $re = '';
    foreach my $char (reverse @chars) {
        $re = '(?:' . $char . $re . ')?';
    }
    return $firstChar . $re;
}

[download]

In reply to Re: Complicated pattern match (book recommendations) by gjb
in thread Complicated pattern match by dr_jgbn

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.