Here is my take on your problem, though I might have misinterpreted some things. I am assuming your record is in the following order:
  1. might or might not have a comment at start
  2. might or might not have that row of mostly numbers
  3. first part of right sequence
  4. might or might not have a ! preceded by optional whitespace
  5. first part of left sequence
  6. a blank line, followed by more parts of the right and left sequence
From this data you want populate a hash with the information. So that for each piece of data you have:
#$pkey is just a counter
$c->{$pkey}{left_instance}{sequence}; 
$c->{$pkey}{right_instance}{sequence};
$c->{$pkey}{comments};
#i am guessing $c->{$pkey}{match} as well but don't know 
#what that does.

[download]
I am also guessing that since you pass your hashref to _load_stats that you further add data from the "stats" line into your hash, so I added $c->{$pkey}{stats} as well. If nothing else it might give you a different approach from which to work from. Again keep in mind that I am just working from your one example of a record, some of my assumptions in my regular expressions will probably need some tweaking. Anyhow code follows:
use strict;
use warnings;
use Data::Dumper;

$/ = "\n\n\n";

my $pkey = 1;
my $c = {};

while ( <DATA> ) {
  #get comments if any
  $c->{$pkey}{comments} = $1 if s/^(#[^\n]+)\n//;

  #get stats if any
  _load_stats($pkey,$1,$c) if !/^Sbjct/ and s/\s*(\d[^\n]+)//;

  #loop over remaining data to get sequences
  while ( /Sbjct: ([-ACGT]+)\s+\d+\n(?:\s*!\s+)?Sbjct: ([-ACTG]+)/g) {
     $c->{$pkey}{left_instance}{sequence} .= $1;
     $c->{$pkey}{right_instance}{sequence} .= $2;
  }

  #add 1 to $pkey for next one
  #though we should probably be using an AoH
  #instead of a HoA so we don't need the counter
  #and can just use push.
  $pkey++;
}

#print resulting structure for verification
print Dumper $c;


#don't know what _load_stats really does
#so this will need changing
sub _load_stats
{
  my ($pkey,$data,$href) = @_;
  $href->{$pkey}{stats} = [split ' ',$data];
}   ##_load_stats



__DATA__
# args=-supermax -d -l 50 -h 7 -seedlength 7 -evalue 0.0001 -s 60 /hom
+e/anonymous_monk/clusters/all/all_clusters
140     8778      333   D   140     8778      334  -7    3.60e-56   -2
+59    95.00
Sbjct: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA   
+      393
       !
Sbjct: -AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA   
+      394

Sbjct: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGCCTT   
+      453
Sbjct: AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGCCTT   
+      454

Sbjct: TTAAAATTCCCCCC-GGGGGG                                          
+      474
                     !
Sbjct: TTAAAATTCCCCCCGGGGGGG                                          
+      475


   170     8778      333   D   140     8778      334  -7    3.60e-56  
+ -259    95.00
Sbjct: CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA   
+      393
       !
Sbjct: -CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA   
+      394

Sbjct: CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGCCTT   
+      453
Sbjct: TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGCCTT   
+      454

Sbjct: GTAAAATTCCCCCC-GGGGGG                                          
+      474
                     !
Sbjct: GTAAAATTCCCCCCGGGGGGG                                          
+      475


# args=-supermax -d -l 50 -h 7 -seedlength 7 -evalue 0.0001 -s 655 /ho
+me/anonymous_monk/clusters/all/all_clusters
Sbjct: CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA   
+      393
       !
Sbjct: -CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA   
+      394

Sbjct: CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGCCTT   
+      453
Sbjct: TAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGGGGGGGGGCCTT   
+      454

Sbjct: CCAAAATTCCCCCC-GGGGGG                                          
+      474
                     !
Sbjct: CCAAAATTCCCCCCGGGGGGG                                          
+      475

[download]

-enlil

In reply to Re: More efficient? by Enlil
in thread Improve code to parse genetic record by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.