Hola Monks,

I am trying to extract the first and last Query and Subject numbers from data like the following: 
><a name = 32169281></a><a href="http://www.ncbi.nlm.nih.gov/entrez/qu
+ery.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=32169281&dopt=GenBank" 
+>emb|AJ544060.1|GGA544060</a> Gallus gallus mRNA for granzyme A precu
+rsor (GZMA gene)
          Length = 1100

 Score =  721 bits (360), Expect = 0.0
 Identities = 360/360 (100%)
 Strand = Plus / Plus

                                                                      
+ 
Query: 11  catgggtgtttttttcactctgtccacctctgctgccatcgttctcctgatacttcctg
+g 70
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+| 
Sbjct: 1   catgggtgtttttttcactctgtccacctctgctgccatcgttctcctgatacttcctg
+g 60

                                                                      
+ 
Query: 71  agatttgtgcgtggatatcattggaggacatgaagtagcaccacactcaagaccattta
+t 130
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+|
Sbjct: 61  agatttgtgcgtggatatcattggaggacatgaagtagcaccacactcaagaccattta
+t 120

                                                                      
+ 
Query: 131 ggccatgctcaaaggaaaagaattttgtggaggagctttgatcaagccaagctgggtgt
+t 190
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+|
Sbjct: 121 ggccatgctcaaaggaaaagaattttgtggaggagctttgatcaagccaagctgggtgt
+t 180

                                                                      
+ 
Query: 191 aacagctgctcattgcaatctgaagggaggcagagttattcttggagcccattcacgga
+c 250
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+|
Sbjct: 181 aacagctgctcattgcaatctgaagggaggcagagttattcttggagcccattcacgga
+c 240

                                                                      
+ 
Query: 251 aaaaagagaagaagaagaacaggttattgagattgcagaagaaattcgctacccagact
+a 310
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+|
Sbjct: 241 aaaaagagaagaagaagaacaggttattgagattgcagaagaaattcgctacccagact
+a 300

                                                                      
+ 
Query: 311 ctgtcccgaaagaaaggaacatgacattatgctgttgaagcttaagaaaagagcaaaaa
+t 370
           |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||
+|
Sbjct: 301 ctgtcccgaaagaaaggaacatgacattatgctgttgaagcttaagaaaagagcaaaaa
+t 360


><a name = 16647294></a><a href="http://www.ncbi.nlm.nih.gov/entrez/qu
+ery.fcgi?cmd=Retrieve&db=Nucleotide&list_uids=16647294&dopt=GenBank" 
+>gb|AC016999.8|</a> Homo sapiens BAC clone RP11-40B20 from 2, complet
+e sequence
          Length = 93778

 Score = 46.6 bits (23), Expect = 0.028
 Identities = 23/23 (100%)
 Strand = Plus / Minus

                                    
Query: 249   acaaaaagagaagaagaagaaca 271
             |||||||||||||||||||||||
Sbjct: 64265 acaaaaagagaagaagaagaaca 64243

[download]
The results should be 249 64265 271 64243 (for the second, smaller block) and 11 1 370 360 (for the first block). I have tried this, where $id is the <a name=> number:
    my @positions = $string =~ m/<a name = $id>.*?Query: (\d+).*?Sbjct
+: (\d+).*?<\/pre>/s;
    push (@positions, $string =~ m/<a name = $id>.*?Query: \d+\s+[a-z]
++ (\d+)\n.*?\nSbjct: \d+\s+[a-z]+ (\d+)\n<\/pre>/s);

[download]
But this doesn't grab the last query properly. What can I do that avoids getting the wrong 'last' numbers? I need them from the same number block, and combinations of greedy/non-greedy matching aren't working out for me, I either get partial results (not the true last ones) or last ones from the last block in the page.

Help!

Thanks,

Evan



In reply to Regex perplexity by eweaverp

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.