use strict; use Data::Dumper; my @seq; # array of sequences my %seq; # hash lookup of sequences based on id's { local $/ = '>'; while (<DATA>) { s/^>//g; # strip out '>' from beginning s/>$//g; # and end of line next if !length($_); # ignore empty lines my ($header_info) = /^(.*)\n/; # capture the header s/^(.*)\n//; # and strip it out my @rec = split /\|/, $header_info; s/\n//mg; # join the sequence strings push @rec, $_; # make sequence the last element push @seq, \@rec; # push into array of sequences $seq{$rec[1]} = \@rec; # or store in a hash lookup } } print Dumper(\@seq); print Dumper(\%seq); __DATA__ >gi|2695845|emb|Y13255.1|ABY13255 Acipenser baeri mRNA for immunoglobu +lin heavy chain, clone ScH 3.3 TGGTTACAACACTTTCTTCTTTCAATAACCACAATACTGCAGTACAATGGGGATTTTAACAGCTCTCTGT +ATAATAATGA TACCCCCGCGACCTTCTCGTGGACTGATCAATCTGGAAAAGCTTTT >gi|2695846|emb|Y13255.1|ABY13255 Acipenser baeri mRNA for immunoglobu +lin heavy chain, clone ScH 3.3 TGGTTACAACACTTTCTTCTTTCAATAACCACAATACTGCAGTACAATGGGGATTTTAACAGCTCTCTGT +ATAATAATGA TACCCCCGCGACCTTCTCGTGGACTGATCAATCTGGAAAAGCTTTT
In reply to Re: Refomating a large fasta file...
by Roger
in thread Refomating a large fasta file...
by bioinformatics
| For: | Use: | ||
| & | & | ||
| < | < | ||
| > | > | ||
| [ | [ | ||
| ] | ] |