Dear monks, I am trying to extract unique sequences (and there identifiers) from a list like this: 

>atc:AGR_pTi_39_1-45_FD cctttcaagtcatagaacaccggggcatgtacaacttggggaagg
>atc:AGR_pTi_47_1-45_FD ccttacaggtcattgagcacagaggaatgttcaatttagggaaac
>atc:AGR_pTi_39_1-45_F      cctttcaagtcatagaacaccggggcatgtacaacttgggga
+agg
>atc:AGR_pTi_47_1-45_F      ccttacaggtcattgagcacagaggaatgttcaatttaggga
+aac
>atc:AGR_pTi_39_1-45_RD cctttcaagtcatagaacaccggggcatgtacaacttggggaagg
>atc:AGR_pTi_47_1-45_RD ccttacaggtcattgagcacagaggaatgttcaatttagggaaac
>atc:AGR_pTi_39_1-45_R  cctttcaagtcatagaacaccggggcatgtacaacttggggaagg

[download]
I am just comparing the sequences part of each but wish to extract the sequence and the annotation of those that are unique. I have written a script which extracts unique sequences but am failing to extract the annotation. Please can anyone help. 
# my code so far

#!/usr/bin/perl -w
                                                                      
+                                               
open (FILEHANDLE, $ARGV[0]) or die "unable to open file";
open (OUTFILE, ">$ARGV[1]") or die;                                   
+                                                                     
+             
my $line;
my @array;                                                            
+                                                         
my @seqs;
                                                                      
+                                               
while (<FILEHANDLE>)
{
    $line = $_;
    chomp ($line);                                                    
+                                                                 
                                                                      
+                                               
    if ($line =~ /(\S+)(\s+)(\w+)/)   {                               
+                                                                     
+                 
            push @seqs, "$3 ";                                        
+                                                                     
+        
    }                                                                 
+                                                                     
+                                                                     
+                               
}
                                                                      
+                                               
foreach my $item (@seqs)   {
    unless ($seen{$item})   {
          $seen{$item} = 1;
          push (@uniq, $item);
          push @uniq, "\n";
 }                                                                    
+                                                                     
+                                                                     
+                            
    else {                                                            
+                                                         
          push (@duplicates, $item);
          push @duplicates, "\n";                                     
+                                                                     
+           
    }
}
                                                                      
+                                               
print @uniq;                                                          
+                                                           
print OUTFILE "@duplicates\n";                                        
+                                                                     
+        
close FILEHANDLE;
close OUTFILE;
exit;

[download]

BazB added readmore tags

In reply to extracting duplicates from a list by Anonymous Monk

Title:
Use:  <p> text here (a paragraph) </p>
and:  <code> code here </code>
to format your post, it's "PerlMonks-approved HTML":


  • Posts are HTML formatted. Put <p> </p> tags around your paragraphs. Put <code> </code> tags around your code and data!
  • Titles consisting of a single word are discouraged, and in most cases are disallowed outright.
  • Read Where should I post X? if you're not absolutely sure you're posting in the right place.
  • Please read these before you post! —
  • Posts may use any of the Perl Monks Approved HTML tags:
    a, abbr, b, big, blockquote, br, caption, center, col, colgroup, dd, del, details, div, dl, dt, em, font, h1, h2, h3, h4, h5, h6, hr, i, ins, li, ol, p, pre, readmore, small, span, spoiler, strike, strong, sub, summary, sup, table, tbody, td, tfoot, th, thead, tr, tt, u, ul, wbr
  • You may need to use entities for some characters, as follows. (Exception: Within code tags, you can put the characters literally.)
            For:     Use:
    & &amp;
    < &lt;
    > &gt;
    [ &#91;
    ] &#93;
  • Link using PerlMonks shortcuts! What shortcuts can I use for linking?
  • See Writeup Formatting Tips and other pages linked from there for more info.